Clone Read LE_HBa0180A05_SP6_264586

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0180A05_SP6_264586
Primer
SP6
ID from Seq. Facility
LE_HBa_180_A05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
571 trimmed for vector and quality, 934 raw
Genbank Accession
Sequence
>LE_HBa0180A05_SP6_264586 (raw untrimmed)
NGAGCAGTCCCTTTCCTTGCAACATAGGGTTGTGGCAGACGATCAGTTGAGATTAGTGAATGTGCAAATAGAGGTATTCATAACACTCCTTTATAAGTTA
TTCTGCTTATCTAACAGGCCTTTATGAGGTTGAAGAACTCTATTTTTTTTTATTGAACTTGCAGATGGAGAATAGTTCTTACTTTATTGCATCTCGGCAT
AAACTGAGTGCCTTCTTCTCTCTTATATTCCGTTTCTCTTCGTGTCACCATCCCCTGCTAGCTTCGGCCCTGGCAAAGATAATGCAAGATGAGGGGAATC
GTGTAGTTGTTGGGAAAGATGAGAACGCTGTGAGGCAACTCATAAGTATGATCAGTAGTGACAATCAGCATGTGGTATGCTAGATTATACTCTGTAGGAT
GCTTTGACCTAATTCCAATTCAATCAATGCATAAATAACTGTGTTTCTTGTTCAGGTAGAACAAGCTTGCTCTGCTCTTTCTTCTCTTGCCACAGACGTT
TCTGTGGCAATGCAGTTAATGAAATCAGATATTATGCAACCCATAGAAAGAGTACTAAAATCTGCTGGTCCTGAGGAAGTCATATCTGTGTTGCAAGTTT
TGGGAAATTTGGCCTTTGCATCAAATATTGTATCCTCAAAACCGCTGAACAAGGGAGTACTGAGATCCTTGAAACCTTTTGTGGGCCCCCAGAAATTCCT
GAAGGCAAATCCTCCCTTGGTCTCCTTTTTGTGGTTGGGGAAATCACTCATGTATAACGTGTTTCCTGGTTTCCGATCAAATGTTTCTTCACAATAAACC
TCTTTTATCTCCCCGAGGTGCAAAGACTAACTCTCTTATTCCGGTTGGTACTTTGACCGATTTCGTCGTTAGAAAAATCCCCCTGTATTAAAGCTTGTCA
TCGTGACACTTCATCTGCAAGTCCTTATTGTAGA
>LE_HBa0180A05_SP6_264586 (trimmed for quality and cloning vector)
AGGGTTGTGGCAGACGATCAGTTGAGATTAGTGAATGTGCAAATAGAGGTATTCATAACACTCCTTTATAAGTTATTCTGCTTATCTAACAGGCCTTTAT
GAGGTTGAAGAACTCTATTTTTTTTTATTGAACTTGCAGATGGAGAATAGTTCTTACTTTATTGCATCTCGGCATAAACTGAGTGCCTTCTTCTCTCTTA
TATTCCGTTTCTCTTCGTGTCACCATCCCCTGCTAGCTTCGGCCCTGGCAAAGATAATGCAAGATGAGGGGAATCGTGTAGTTGTTGGGAAAGATGAGAA
CGCTGTGAGGCAACTCATAAGTATGATCAGTAGTGACAATCAGCATGTGGTATGCTAGATTATACTCTGTAGGATGCTTTGACCTAATTCCAATTCAATC
AATGCATAAATAACTGTGTTTCTTGTTCAGGTAGAACAAGCTTGCTCTGCTCTTTCTTCTCTTGCCACAGACGTTTCTGTGGCAATGCAGTTAATGAAAT
CAGATATTATGCAACCCATAGAAAGAGTACTAAAATCTGCTGGTCCTGAGGAAGTCATATCTGTGTTGCAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961637
Expected error %
0.203465
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g61850.1 Score 170 E Value 6e-43 Identity 22.40% Align. Length 428bp (74.96%) Frame 3
68414.m06979 patatin family protein similar to membrane-associated calcium-independent phospholipase A2 gamma; IPLA2 gamma [Homo sapiens] GI:8453174; contains Patatin domain PF01734, PF00514: Armadillo/beta-catenin-like repeat
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_176378.1| Score 170 E Value 2e-41 Identity 22.40% Align. Length 428bp (74.96%) Frame 3
patatin family protein [Arabidopsis thaliana] gb|AAC28504.1| Contains similarity to gb|U51898 Ca2+-independent phospholipase A2 from Rattus norvegicus. [Arabidopsis thaliana] pir||T02131 hypothetical protein F8K4.6 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD30421.1| Score 161 E Value 1e-38 Identity 20.20% Align. Length 434bp (76.01%) Frame 3
putative calcium-independent phospholipase A2 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0180A05
Clone
Clone name
hba-180a5
LE_HBa0180A05
P180A05
Clone type
BAC
Contamination
none
Estimated length
48,660
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found