Clone Read LE_HBa0185O08_SP6_266299

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0185O08_SP6_266299
Primer
SP6
ID from Seq. Facility
LE_HBa_185_O08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
507 trimmed for vector and quality, 975 raw
Sequence
>LE_HBa0185O08_SP6_266299 (raw untrimmed)
CTATATCTTGTACTTCATCTAGGTTATTTTACAGAAATTTGAATTTTTTTGTTTTCTTAACATACATACTAATCATTCTATCATATTCATACTTGTTCAC
CATCAACCATCTAACATTAAGATCATTAAATGAATCACATAGTTTAATATAGCATTAAATGTATACTTGCAAAAATGGTACCAATACAATGTCTGAAAAA
AACGGAAAGATATGCTAGTGGAACATACTCCACTAACCAATCCTATAACTAAGCTAGAATATAATGGGCAAGCATCCACAAAATCATGAGTTCCTACCAT
GTCCGGATGAATACTCTACATCCGGATAGTCTCAGCGTCAACCTGTAGCACTAGCGTCCACCTGTGTCTGCACCTAAAATTGTAGAGTTGTATAGGGTTA
GTACACACTTGTACTATGTATGGGTACATGCAAGCACACACAAATGACATGCATGAGTAAGAATAGTTCTTTCCTAACAACATGATTATGGAAAGTCAAG
TCAGTGGACTTGTCAAATTGGGATTAGAAAAGTTGGTGAGCTTTCCAAATTTTTGTTAAGCAAAGTGAGAGAACTTCTGAAATTTGGATTAGGAAAGTCA
TGCCATGAAAGTAAACATGCATCATGTTACTTATCTTATTGCACACAGCTAATAACTTTTTGCTATTAACACATAAGATATTGCATTATTACACATTAAA
TATGTCCATTAGACCTTTGAAATTAGGTGACATTTCATTAAAGTCCTTCCCAAAAATAAGGGGTTTAAAATTTTGGGTACTCCAACTTATTGGAGGCCTT
TTTTTCTAAAAACAACAAATTCTACCCACATTTTATTCCGATATTCAATATATTTTCCTTTGATTTTTCCATAATCAAAATCATTAACTCACTCTTATTA
TAATTATGATTTATTTTTTTAATTTTTTATTAAGGTTCTATTGTATGCTATACTATTATAAATTTCTTATCAATC
>LE_HBa0185O08_SP6_266299 (trimmed for quality and cloning vector)
TCTAGGTTATTTTACAGAAATTTGAATTTTTTTGTTTTCTTAACATACATACTAATCATTCTATCATATTCATACTTGTTCACCATCAACCATCTAACAT
TAAGATCATTAAATGAATCACATAGTTTAATATAGCATTAAATGTATACTTGCAAAAATGGTACCAATACAATGTCTGAAAAAAACGGAAAGATATGCTA
GTGGAACATACTCCACTAACCAATCCTATAACTAAGCTAGAATATAATGGGCAAGCATCCACAAAATCATGAGTTCCTACCATGTCCGGATGAATACTCT
ACATCCGGATAGTCTCAGCGTCAACCTGTAGCACTAGCGTCCACCTGTGTCTGCACCTAAAATTGTAGAGTTGTATAGGGTTAGTACACACTTGTACTAT
GTATGGGTACATGCAAGCACACACAAATGACATGCATGAGTAAGAATAGTTCTTTCCTAACAACATGATTATGGAAAGTCAAGTCAGTGGACTTGTCAAA
TTGGGAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95114
Expected error %
0.0726286
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0185O08
Clone
Clone name
hba-185o8
LE_HBa0185O08
C02HBa0185O08
P185O08
Clone type
BAC
Contamination
none
Estimated length
79,775
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found