Clone Read LE_HBa0045N22_SP6_266897

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0045N22_SP6_266897
Primer
SP6
ID from Seq. Facility
LE_HBa_045_N22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
474 trimmed for vector and quality, 714 raw
Genbank Accession
Sequence
>LE_HBa0045N22_SP6_266897 (raw untrimmed)
AAAACCNNNNNGGCACATTTTATATTAACTAGCATATATCTAAGNNTAATTATCTTCTAAACNGGAATAGAAACTTTTGCAAGNTTACCATTTTTAAAAA
TTAAGTGCAAGTTAAGCTACTAAGACACAAACCAAATGAAGTGGCCCATTTCCAAATTTTTATAGACTTATTACACAAAAATGNGTTTTTTTAAAGTGGA
GTTATAAGCCCAACTAGACCCAAACAACTCATTTGTTGGATATGAAATGTAAAGTGGATAATTCACAATCCACCAATAGAAAATAGAAACAATTGAAAAT
GGCTAATATCCAAATGTGTGGCTATACTAGTTACTTGGCTTATCTAGTCATTGAGTGACTCTCATCATCTTTCTAGTAATCTACTATTGTTCTCTACATT
ACAAGAATAACATCCCCATCCACTTCCTCTCTTCTCAACACACACATTAATTAACATGGCTTCTTCCACTCTTTCTCATGTAACTCCTTCTCAGGTAATG
CGCGGAGCTAGTTAGGCTAACATCCATCGAAAAATTATACTGTATATATAAATCTTATTAAAAATTATTTTGTTATATGTATATATATATAAGTTTTTTA
ATGAAAAATTCTGACTTCAACTAACTACCTGTAACCAATTTTTTTTGTTTAAAAAATTTTCCAACCTATGGCCTCCAAAGAAAAAAATGTGGTTATTTTC
CCTCTCCGGTTTTC
>LE_HBa0045N22_SP6_266897 (trimmed for quality and cloning vector)
TTAAAAATTAAGTGCAAGTTAAGCTACTAAGACACAAACCAAATGAAGTGGCCCATTTCCAAATTTTTATAGACTTATTACACAAAAATGNGTTTTTTTA
AAGTGGAGTTATAAGCCCAACTAGACCCAAACAACTCATTTGTTGGATATGAAATGTAAAGTGGATAATTCACAATCCACCAATAGAAAATAGAAACAAT
TGAAAATGGCTAATATCCAAATGTGTGGCTATACTAGTTACTTGGCTTATCTAGTCATTGAGTGACTCTCATCATCTTTCTAGTAATCTACTATTGTTCT
CTACATTACAAGAATAACATCCCCATCCACTTCCTCTCTTCTCAACACACACATTAATTAACATGGCTTCTTCCACTCTTTCTCATGTAACTCCTTCTCA
GGTAATGCGCGGAGCTAGTTAGGCTAACATCCATCGAAAAATTATACTGTATATATAAATCTTATTAAAAATTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.936271
Expected error %
0.448408
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0045N22
Clone
Clone name
hba-45n22
LE_HBa0045N22
C12HBa0045N22
P045N22
Clone type
BAC
Contamination
none
Estimated length
91,519
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found