Clone Read LE_HBa0107H12_SP6_267056

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0107H12_SP6_267056
Primer
SP6
ID from Seq. Facility
LE_HBa_107_H12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
617 trimmed for vector and quality, 871 raw
Genbank Accession
Sequence
>LE_HBa0107H12_SP6_267056 (raw untrimmed)
TTTTCGATAATTGATTTTCCAGATTATGATATCACTAAAAATAGTATAACTTTTCTTTTTTTTTATGTCATTCTATAGAACTAAGTACTAACTATTATTC
TTTATAATTGAAAAGGTAAAGTCTTTGATCCTAAAAAATATATAATTCAAATGTACATTTTTTTGTTAATTATGATTATATATCTTTTATTTATTTAATT
TTATTTTGAATAATAAATAATAGTGTAAAATAAGCAAATCGTGTATTCGTATTGACATTACTTAAAGTGCATTAAACATATTTTTGATCTTGTTATTACA
TAAATTTATTTTATATTAAAAAGTTATAAGATTTTTTTTATTTTTATGATACAATAAAACTTTTTTTTTTTTTGGTTAAAACAGAACCAAAGGTCCACTT
TATTTTAAATGGGCATGACCTAATTCTAGAATGAAACAAAAAGAAAAACAGAATTCCGCAAGACAACAAAATTAAAAAAATGAAAGACAAATACCGAAGC
CTGTTCAACATTTTCATCTAAAAAAAGATTAAAATATTTCTTCATATTAAATTATTAATAAAAGCTATTTATTCATGAAAATATGAATAAATATGAGTAA
ACTAATATTTTATTCAACCAATTTATTACTCAATCACTTTTTACCCACATCCAATATCAACGGATTAAATTATTATCCATTTTTAAAGTTGCCCATATTC
ACTCCATCCGTTCATTTGCCCTCACTATTTCCTAAACCAGACAAACTTTTGAAATTCCGGCCCGATTTTTTAATAATTTTAAAAAAATGGTGAAAATTAA
AAACTTATCCCCCCCTTGTTAAAATGTCCCAAAATAAGTTTCTAAAAAAAACCTTTATTTCCCCCAAATAA
>LE_HBa0107H12_SP6_267056 (trimmed for quality and cloning vector)
GATATCACTAAAAATAGTATAACTTTTCTTTTTTTTTATGTCATTCTATAGAACTAAGTACTAACTATTATTCTTTATAATTGAAAAGGTAAAGTCTTTG
ATCCTAAAAAATATATAATTCAAATGTACATTTTTTTGTTAATTATGATTATATATCTTTTATTTATTTAATTTTATTTTGAATAATAAATAATAGTGTA
AAATAAGCAAATCGTGTATTCGTATTGACATTACTTAAAGTGCATTAAACATATTTTTGATCTTGTTATTACATAAATTTATTTTATATTAAAAAGTTAT
AAGATTTTTTTTATTTTTATGATACAATAAAACTTTTTTTTTTTTTGGTTAAAACAGAACCAAAGGTCCACTTTATTTTAAATGGGCATGACCTAATTCT
AGAATGAAACAAAAAGAAAAACAGAATTCCGCAAGACAACAAAATTAAAAAAATGAAAGACAAATACCGAAGCCTGTTCAACATTTTCATCTAAAAAAAG
ATTAAAATATTTCTTCATATTAAATTATTAATAAAAGCTATTTATTCATGAAAATATGAATAAATATGAGTAAACTAATATTTTATTCAACCAATTTATT
ACTCAATCACTTTTTAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.839569
Expected error %
0.286844
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0107H12
Clone
Clone name
hba-107h12
LE_HBa0107H12
C02HBa0107H12
P107H12
Clone type
BAC
Contamination
none
Estimated length
110,622
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found