Clone Read LE_HBa0092O17_SP6_27200

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0092O17_SP6_27200
Primer
SP6
ID from Seq. Facility
LE_HBa_092_O17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
701 trimmed for vector and quality, 902 raw
Sequence
>LE_HBa0092O17_SP6_27200 (raw untrimmed)
GGGGGGCAATTGCTCCTTTGTGCTGGGTCCCCTGATTTTAGCTTGAGAGAGTGAAATATTGAATCTATTTTTTGTACCTTGCTCGATAGAGTAGATAAGA
AGGTTAGACATCTTCAATCAAGAGTGTTGAAGTTCAAGAGAATTCAATAGAGATAAGGTGATTGTTTGTTAGAAAATTGCTTTACATATAGTCCTACCTA
TCCACAAAAATTTATCCCTTAGTGAGCATCAATGTTCATCCACTAAGTTGAATTCAATAACTGGTTGGTCAATTCCCCAAGTATTACCTCACTATTTGAT
CGTCTCGTGTTAAGTGTTAAATTGGTTTGATAATTATAACCAGAAATTAAAGTTAAACCAAAAAGTTGCATTAAGTTGTTAGTCGAAGTTGATGTTGTTA
TACTTCTATTATTGAATTTAAAGTAAAAGCTACTCCCTGTGGAATATATCCAACTAATTTAGTTGGGTTATTCACTTGCTAGTGATCATTGACACTTTGG
ATGAAGTTTCTTTGAAATATTAATGAAAATGGTGTCGTTGTCGGGGCGTAGCATTACTTAGAATTCTTAGATTGAATATTTGGTTTGTGAATGATTTTGT
TGTAGTAGAATGTCTTAGGCTGCATTATGAAGTGTTGATTGGACTGCATAGAAGTAAAAATGAGTGAAGAAGAGGTAAATGGTAGTCAAGAAGGTCATCG
AGACGGTATCGATGATATTAATAGTGTTTACAACCCATCCCTGTGGGTTAAATAGGTGAAAATTCCATACCACAAGCTTATGGGAATGCCATATTTGAGG
TCACTAGCAGGACTCTTCTTCTCCTCCAATGAGATGACTCTATGGAGGGGTAGAGTACAAAACCCGCATGAGTATGTAATAGTTTTATTGGTGGTGGGAG
GC
>LE_HBa0092O17_SP6_27200 (trimmed for quality and cloning vector)
CTGGGTCCCCTGATTTTAGCTTGAGAGAGTGAAATATTGAATCTATTTTTTGTACCTTGCTCGATAGAGTAGATAAGAAGGTTAGACATCTTCAATCAAG
AGTGTTGAAGTTCAAGAGAATTCAATAGAGATAAGGTGATTGTTTGTTAGAAAATTGCTTTACATATAGTCCTACCTATCCACAAAAATTTATCCCTTAG
TGAGCATCAATGTTCATCCACTAAGTTGAATTCAATAACTGGTTGGTCAATTCCCCAAGTATTACCTCACTATTTGATCGTCTCGTGTTAAGTGTTAAAT
TGGTTTGATAATTATAACCAGAAATTAAAGTTAAACCAAAAAGTTGCATTAAGTTGTTAGTCGAAGTTGATGTTGTTATACTTCTATTATTGAATTTAAA
GTAAAAGCTACTCCCTGTGGAATATATCCAACTAATTTAGTTGGGTTATTCACTTGCTAGTGATCATTGACACTTTGGATGAAGTTTCTTTGAAATATTA
ATGAAAATGGTGTCGTTGTCGGGGCGTAGCATTACTTAGAATTCTTAGATTGAATATTTGGTTTGTGAATGATTTTGTTGTAGTAGAATGTCTTAGGCTG
CATTATGAAGTGTTGATTGGACTGCATAGAAGTAAAAATGAGTGAAGAAGAGGTAAATGGTAGTCAAGAAGGTCATCGAGACGGTATCGATGATATTAAT
A

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.936791
Expected error %
0.0575323
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0092O17
Clone
Clone name
hba-92o17
LE_HBa0092O17
P092O17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found