Clone Read LE_HBa0092O17_T7_27201

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0092O17_T7_27201
Primer
T7
ID from Seq. Facility
LE_HBa_092_O17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
754 trimmed for vector and quality, 865 raw
Sequence
>LE_HBa0092O17_T7_27201 (raw untrimmed)
CGATGCGTTGGTACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAACCAAAGGCTAAAAAGGTCATTTTTGTAAGATATGTAGATAGAG
TAAAAGGGTAGAAACTTTGGTGTTTGTCTTTACTCAAATTTGTAGTTAGTAGAGATGTTTCTTTTGATGAATCCTCTATACTTGATCCTCGTAAAGTCTC
TGTGGAGTTATCAAGAGACGGGAACAACGAGCAGGTGGAGATACCGGTGGAGCTTACCAAGGAACGAGATCAAGAGACTTAAATTGATGAGTCAAAAGAT
GCAGATCTTAAAGAACTTGCTGCCAATGAACCATACACAACTGCGAATGGAAGGGACAAAAGACAGATACGGAAACCGAAATGTCTTATAGAGCAAGAAA
ATCTTATTGCACATACGTTCGTAGCTGCAAAAGAAGAGATTAAGGATCTCGAGCCCTCTTCATATGTTGAAGCAACTTCTTGCAAAGATGTTGCACAGTG
GCAGTTAGCTATGATGGAAGAGATGGAGTCTATTTAAAAAAATGAGACATGGGTCTTAGTTAAAAGTCCAAAGGGGATGAGGACAGTTGGATACAAATGG
GTCTACAGAAAGAAAGAAGGTATTGCATAAGTGGAAGATGCTAGGTTTAAGCAGAGATTGGTTGCAAAGGGTTTCTGTCAGAAGGAGGGAATGACTACAA
TGAGATCTTCTCTCCAGTCATGAAACATTAATCAATTTGTGTGCTACTAGCATTGGTTGGCACAATTTTTATTTTACAATTTCAACAGCTTGGATGTTCA
AAACTGCCTTCTTACATTGGTGATTTACAAAAGATATTCCATATGACAACCTTGAAGGTTCCCAG
>LE_HBa0092O17_T7_27201 (trimmed for quality and cloning vector)
AGCTTGAACCAAAGGCTAAAAAGGTCATTTTTGTAAGATATGTAGATAGAGTAAAAGGGTAGAAACTTTGGTGTTTGTCTTTACTCAAATTTGTAGTTAG
TAGAGATGTTTCTTTTGATGAATCCTCTATACTTGATCCTCGTAAAGTCTCTGTGGAGTTATCAAGAGACGGGAACAACGAGCAGGTGGAGATACCGGTG
GAGCTTACCAAGGAACGAGATCAAGAGACTTAAATTGATGAGTCAAAAGATGCAGATCTTAAAGAACTTGCTGCCAATGAACCATACACAACTGCGAATG
GAAGGGACAAAAGACAGATACGGAAACCGAAATGTCTTATAGAGCAAGAAAATCTTATTGCACATACGTTCGTAGCTGCAAAAGAAGAGATTAAGGATCT
CGAGCCCTCTTCATATGTTGAAGCAACTTCTTGCAAAGATGTTGCACAGTGGCAGTTAGCTATGATGGAAGAGATGGAGTCTATTTAAAAAAATGAGACA
TGGGTCTTAGTTAAAAGTCCAAAGGGGATGAGGACAGTTGGATACAAATGGGTCTACAGAAAGAAAGAAGGTATTGCATAAGTGGAAGATGCTAGGTTTA
AGCAGAGATTGGTTGCAAAGGGTTTCTGTCAGAAGGAGGGAATGACTACAATGAGATCTTCTCTCCAGTCATGAAACATTAATCAATTTGTGTGCTACTA
GCATTGGTTGGCACAATTTTTATTTTACAATTTCAACAGCTTGGATGTTCAAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.952068
Expected error %
0.6253
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP54315.1| Score 138 E Value 1e-31 Identity 13.20% Align. Length 641bp (85.01%) Frame 1
putative polyprotein [Oryza sativa (japonica cultivar-group)] ref|NP_922028.1| putative polyprotein [Oryza sativa (japonica cultivar-group)] gb|AAM91886.1| putative polyprotein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAX92941.1| Score 137 E Value 3e-31 Identity 13.40% Align. Length 641bp (85.01%) Frame 1
retrotransposon protein, putative, Ty1-copia sub-class [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0092O17
Clone
Clone name
hba-92o17
LE_HBa0092O17
P092O17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found