Clone Read LE_HBa0094C12_T7_27383

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0094C12_T7_27383
Primer
T7
ID from Seq. Facility
LE_HBa_094_C12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
504 trimmed for vector and quality, 828 raw
Sequence
>LE_HBa0094C12_T7_27383 (raw untrimmed)
GTTCCGGGGGGGTCCTCTTGAGTCGACCTGCAGGCATGCAAGCTTTAGTAACCTTAGAGTCTACCACCCCTTTAAAAAGTCTTAAAAAAAGTTATTTCTG
AATCCATCAGGCCTTTGGACACAGTCAAGATCCATGGTCATCAAGTTGCTTTTTATCTCTTTATCCATCGGAAATGTTGTCAATGCATGGTTGATATCAT
CTGTGATAGTAATGTCGATACCCTCCAAGGCTTGGATGTATTTATAACCAGGTACCTGACCAGATACCCTCCAATGCTTGGATGTATTTATAATCAGGTA
CTTAACTCCTGCTTTAGACACATTAGCATTACCTTGTACCCATGGTTGATACTCGTCCAATATCTTATTGATCCTTATCCTTTTTCATCTGTCTTGGATA
ACCATATGGAAGTATGTTGAGTTTGTAACCCCATTTACTAGATATCACACTTTTGCTTTTTCTCTCAGTTTGTTCTCTTGAAGTTTTAAGAAAGACACAT
ACTCAACTTTCGTCTTATTGAGTGTAGTTCTTGTATTTGGAGACCAATCACGCTGCATGGTATATTCCATGTTCATGATCTCCTTTTCCCATCTCTTGAA
AACTTCATAAAAATCCTCCTTATGTATCTTAATGACCATGTGTCTAAAATCCTTTTGGGGTTTTGTATAAATCATTCATAATTATGTAATTATTTACAAT
ATAAATATATTAATTTGATAAGGGTGAATTCCTCTATATTTGATATAAATTTGTGGATTACCTTAAAACATAGGGTTAATCTTTTTTTAGTTAAATAAAT
CCTTTAAATAATTATTTTTGTAAGGTAC
>LE_HBa0094C12_T7_27383 (trimmed for quality and cloning vector)
ACCTGCAGGCATGCAAGCTTTAGTAACCTTAGAGTCTACCACCCCTTTAAAAAGTCTTAAAAAAAGTTATTTCTGAATCCATCAGGCCTTTGGACACAGT
CAAGATCCATGGTCATCAAGTTGCTTTTTATCTCTTTATCCATCGGAAATGTTGTCAATGCATGGTTGATATCATCTGTGATAGTAATGTCGATACCCTC
CAAGGCTTGGATGTATTTATAACCAGGTACCTGACCAGATACCCTCCAATGCTTGGATGTATTTATAATCAGGTACTTAACTCCTGCTTTAGACACATTA
GCATTACCTTGTACCCATGGTTGATACTCGTCCAATATCTTATTGATCCTTATCCTTTTTCATCTGTCTTGGATAACCATATGGAAGTATGTTGAGTTTG
TAACCCCATTTACTAGATATCACACTTTTGCTTTTTCTCTCAGTTTGTTCTCTTGAAGTTTTAAGAAAGACACATACTCAACTTTCGTCTTATTGAGTGT
AGTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952015
Expected error %
0.379691
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0094C12
Clone
Clone name
hba-94c12
LE_HBa0094C12
P094C12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found