Clone Read LE_HBa0094C13_T7_27385

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0094C13_T7_27385
Primer
T7
ID from Seq. Facility
LE_HBa_094_C13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
195 trimmed for vector and quality, 881 raw
Sequence
>LE_HBa0094C13_T7_27385 (raw untrimmed)
TGTTCTGCTCTGGGGGGATCCTTCTCTATTCAACCTGCAGGCATGCAAGCTTAATGTTGTTATTCCTATTCCCTCCTTTGTCGAATAGTCATTTTACACA
ATCTTCTTTTGTGTCCCCACTCTCTTAGAATGAATTGCAACATATTTAAAAACATACTTTAACTGAAAAAAGTGTTCCTTAGCAAATTCACAAGAACTGT
GTTGGTACTTTACATGTTTTCACGCAGACAGAACAAAACATAACTGTAGCAGAAACTGATACCTTGAATTAGCAATATGATAATTTTTCTCTTCAATGGT
ATTTGACCTCAGACTCAGGCACGATCATCAGTTGTCCTCGATATTTCTCTGCTAAAACTTAAAAGACAGAGACTATTTATTATTATGATAATAGGATATA
TCTTCTTTCTTTTTAATTTGCTTAATCTGGATGATCCTTCCTTACATTTCACTTTGCGATCTTATATCTTTGAGTAAGATAATTGTGGGTTAGACACTAA
TTAAGATGATAACATAGTTAAATCACCTGATGCATATCTTGTTTAATATATTTTGTTTCTTTATATTATTCTTGTCTTGTCTTGTTATGATATTACTCAC
TATTATCTCTAACATTCTACCCCACTTAATCTTTTCGAGGTTTTCCATTGTTCCCGATTTTTTTCTCTTATTCCTCTCTCATGTAGATCATATTCATTTA
TACTTTGATTAAACCTGCCGTTATGAAGTGTTATAATGTTTATGTATTTTTTTTAAATTATATCTCCTACCTTTTAATAATATTTATCCTTTTCTTTTTG
TCTCTCTCTTTTTCTGTTTTAATTTGTTTTCTTTTTGATCTTTTCTATGCTTTTAGCTTCATTTACTTCTTTTTTTTTCTC
>LE_HBa0094C13_T7_27385 (trimmed for quality and cloning vector)
TCATTTTACACAATCTTCTTTTGTGTCCCCACTCTCTTAGAATGAATTGCAACATATTTAAAAACATACTTTAACTGAAAAAAGTGTTCCTTAGCAAATT
CACAAGAACTGTGTTGGTACTTTACATGTTTTCACGCAGACAGAACAAAACATAACTGTAGCAGAAACTGATACCTTGAATTAGCAATATGATAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.910374
Expected error %
1.11746
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0094C13
Clone
Clone name
hba-94c13
LE_HBa0094C13
P094C13
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found