Clone Read LE_HBa0094E11_T7_27477

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0094E11_T7_27477
Primer
T7
ID from Seq. Facility
LE_HBa_094_E11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
773 trimmed for vector and quality, 832 raw
Sequence
>LE_HBa0094E11_T7_27477 (raw untrimmed)
CTCGGGTCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCCATCTAGCAAAAATCTGTTTCGTTCAATATTTTTGACATCCTTTTGATGG
ATTTCTTTAGCACATTTACAGTCCACTCTAAGAAGAAATTCTTTGTTAACTAGATCATCTTGGAACTTGGTTATGCAAAGAACAATATCTACGACTTCCT
TTTTGATCATGCTATAATTCTTTTGGGCAGAATTCCAGGTTCCTGATTAATAACGGACCAGCTGCTCCGTAGATTTGGGGTCTTTTCTTTGTTTAAGAAT
GCCACCATATCCGATGTCAGAAGCATCAATCTCAACAATCATAAAAAAGTCTGGGTAAGAGATACCTAAGCAAGGAAGGTTCTTAACCATATCTTTAAGT
AGAACAACTGCCTTAGTATGATCGTTACCCCAGGGTGAAGGATTCTTCTTTAACCTGTCATAGAGGGGCTTGCAAATATGTCTAACTTTAGGAATAAAGT
CAGCTACATAGTTAAGACTCCCGAGAAATCTCTGTAGTTGAGTTTAATCCAGGATGACATCTGGGAAATCATTTGAAAACTCAATAGACCTGCACATTGG
TTTATAGGTGCCTTGATAAAGATCATGCCCTAAAAATCTAATTTTTGTCTGAAATACTTTTATTTTCTTAGCACTAATGACAAGACCATTGTGCTTAACA
ATTTTAAGGAAAATATTCAAATGTTTAAAATGAGAATCAATGTCTTCAGAAAAGATTAAACCATCTTCATATAAATTATTGACATCTGGCTAATATGATT
AAAGATGGAGTTCATGATGTTTTGAAATTCTG
>LE_HBa0094E11_T7_27477 (trimmed for quality and cloning vector)
AGCTTGCCATCTAGCAAAAATCTGTTTCGTTCAATATTTTTGACATCCTTTTGATGGATTTCTTTAGCACATTTACAGTCCACTCTAAGAAGAAATTCTT
TGTTAACTAGATCATCTTGGAACTTGGTTATGCAAAGAACAATATCTACGACTTCCTTTTTGATCATGCTATAATTCTTTTGGGCAGAATTCCAGGTTCC
TGATTAATAACGGACCAGCTGCTCCGTAGATTTGGGGTCTTTTCTTTGTTTAAGAATGCCACCATATCCGATGTCAGAAGCATCAATCTCAACAATCATA
AAAAAGTCTGGGTAAGAGATACCTAAGCAAGGAAGGTTCTTAACCATATCTTTAAGTAGAACAACTGCCTTAGTATGATCGTTACCCCAGGGTGAAGGAT
TCTTCTTTAACCTGTCATAGAGGGGCTTGCAAATATGTCTAACTTTAGGAATAAAGTCAGCTACATAGTTAAGACTCCCGAGAAATCTCTGTAGTTGAGT
TTAATCCAGGATGACATCTGGGAAATCATTTGAAAACTCAATAGACCTGCACATTGGTTTATAGGTGCCTTGATAAAGATCATGCCCTAAAAATCTAATT
TTTGTCTGAAATACTTTTATTTTCTTAGCACTAATGACAAGACCATTGTGCTTAACAATTTTAAGGAAAATATTCAAATGTTTAAAATGAGAATCAATGT
CTTCAGAAAAGATTAAACCATCTTCATATAAATTATTGACATCTGGCTAATATGATTAAAGATGGAGTTCATG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.950265
Expected error %
0.930613
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|P03556|POL_CAMVD Score 151 E Value 2e-35 Identity 13.10% Align. Length 647bp (83.70%) Frame 1
Enzymatic polyprotein [Contains: Aspartic protease ; Endonuclease; Reverse transcriptase ]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA23460.1| Score 151 E Value 2e-35 Identity 13.10% Align. Length 647bp (83.70%) Frame 1
reading frame (V) [Cauliflower mosaic virus] sp|P03554|POL_CAMVS Enzymatic polyprotein [Contains: Aspartic protease ; Endonuclease; Reverse transcriptase ] ref|NP_056728.1| reverse transcriptase [Cauliflower mosaic virus]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0094E11
Clone
Clone name
hba-94e11
LE_HBa0094E11
P094E11
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found