Clone Read LE_HBa0094F12_SP6_27526

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0094F12_SP6_27526
Primer
SP6
ID from Seq. Facility
LE_HBa_094_F12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
713 trimmed for vector and quality, 739 raw
Sequence
>LE_HBa0094F12_SP6_27526 (raw untrimmed)
GGTTTTTTTCTTTTTAGAGATATTTATCTTTTAATGATGCCCATATCTTATTGAAATTAGACAAATTTACTACCAGAAAATAAGTGTTTTAACCAATATT
TGTGAGCCAATTTTCTAATTGATTAATAGGTGCCAACTTATATGCATTTTCTTTTCGCAAGTTATAACTTAGAAACGCTTCTTCAAAAGAATTTTGGCAA
AACACAAACTACTAACGAAAGCAGTTCTCAAACAAGTTAACCAAATACTACGACACCATGGTGCATGTAGTTAAGGCAAGTGCAGACTGAAATAGTGTGC
CTCACTACCACATAGGATCAGTTATTATGTCTTAGTTTAAAATCATGCCCAGTTCTCCTCGCCTAAAATATTAGAAAGGGGGCATTAGTAAAATAGTTAA
ATGATGAGGATCAACCTTCTACTCCCATTACCAAACTGGGCGTACTTACAATGTCACTTAAAGTCACCAAGATTCAGATTAAGTTAACACTATTTATATG
TTCTTCCATGCTAAATCTCATGTCAAAGAGCATCAGGCATCAGCATCTTCAGTTACTAAAGTTCAATATATCTTACCAAGGAAGGAAATCAAAAACTATA
AGAAGTGATCAAAAGTAATTAATGGTTCAATTACATAAACACATCAGAAGTCGGAACTATGAGTATATCAAATGCTTTGGAAATTGTTCTGCCTGATGAC
AATTCAACTTTAATGACTGGCCGAAAATCACGAAAAAAG
>LE_HBa0094F12_SP6_27526 (trimmed for quality and cloning vector)
AGAGATATTTATCTTTTAATGATGCCCATATCTTATTGAAATTAGACAAATTTACTACCAGAAAATAAGTGTTTTAACCAATATTTGTGAGCCAATTTTC
TAATTGATTAATAGGTGCCAACTTATATGCATTTTCTTTTCGCAAGTTATAACTTAGAAACGCTTCTTCAAAAGAATTTTGGCAAAACACAAACTACTAA
CGAAAGCAGTTCTCAAACAAGTTAACCAAATACTACGACACCATGGTGCATGTAGTTAAGGCAAGTGCAGACTGAAATAGTGTGCCTCACTACCACATAG
GATCAGTTATTATGTCTTAGTTTAAAATCATGCCCAGTTCTCCTCGCCTAAAATATTAGAAAGGGGGCATTAGTAAAATAGTTAAATGATGAGGATCAAC
CTTCTACTCCCATTACCAAACTGGGCGTACTTACAATGTCACTTAAAGTCACCAAGATTCAGATTAAGTTAACACTATTTATATGTTCTTCCATGCTAAA
TCTCATGTCAAAGAGCATCAGGCATCAGCATCTTCAGTTACTAAAGTTCAATATATCTTACCAAGGAAGGAAATCAAAAACTATAAGAAGTGATCAAAAG
TAATTAATGGTTCAATTACATAAACACATCAGAAGTCGGAACTATGAGTATATCAAATGCTTTGGAAATTGTTCTGCCTGATGACAATTCAACTTTAATG
ACTGGCCGAAAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.949673
Expected error %
0.0306028
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0094F12
Clone
Clone name
hba-94f12
LE_HBa0094F12
C03HBa0094F12
P094F12
Clone type
BAC
Contamination
none
Estimated length
71,761
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found