Clone Read LE_HBa0094F12_T7_27527

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0094F12_T7_27527
Primer
T7
ID from Seq. Facility
LE_HBa_094_F12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
711 trimmed for vector and quality, 755 raw
Sequence
>LE_HBa0094F12_T7_27527 (raw untrimmed)
TTCGGTTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTTTTGGTTGACCACCACTGCCTTTGATAGTAGTATTAATATATATTTAG
ATCAGTGATTTGACTTTTATTTTTCCAGCTCAGCTTAGCTTACAGATTATATTTCTTGTATTAGATATCGTTTATTATTACCAACTGAATATTATGACTT
TTTTGGTTGTTAAAATAGAATGTGTAATTAATCTTTGGTTTCCCATTTTTCACGTTTCGCCTTCATGAAGATGTGAAGTTCTCTGTGAATCTTGTTAGTG
TTAATTACGGTAGTAATACTAACCTTTTTGAGGAAAAGAACAATTAGTATTGAATTAGTAAATACACTCTTTCATCGTTTATTCAAGATTTTAGATTAGT
CCTTTTGGTAGGGAGACCTTTACTCACAAGGTAAGACTTCTAAGTGTGTATCTAAATAAGTTGGTTGGAAAACGAAAAAGAAGAACATTTTGTGAAAGAA
ACTTGGGGGCAACTGCAAAATTGATGACTGTTTTGACTTTTGTGAGCATGGAATACGAATTTCTTTACTCGTAAACCTTTGGTACTAAACGAAAGAAACA
TAAACCAACTCCATAGGTAGACCTGACCACATGTGAAACTAAGAAAAAATTTATCAAACGAGTGATTTGATTTCATTCTTCCTTGCAATATGAACTTGGA
AATAAGATTGAAGCTCAACTTTATTTTTTTTGGACAAAATCTATCACACCAGATG
>LE_HBa0094F12_T7_27527 (trimmed for quality and cloning vector)
AGCTTTTTTTTGGTTGACCACCACTGCCTTTGATAGTAGTATTAATATATATTTAGATCAGTGATTTGACTTTTATTTTTCCAGCTCAGCTTAGCTTACA
GATTATATTTCTTGTATTAGATATCGTTTATTATTACCAACTGAATATTATGACTTTTTTGGTTGTTAAAATAGAATGTGTAATTAATCTTTGGTTTCCC
ATTTTTCACGTTTCGCCTTCATGAAGATGTGAAGTTCTCTGTGAATCTTGTTAGTGTTAATTACGGTAGTAATACTAACCTTTTTGAGGAAAAGAACAAT
TAGTATTGAATTAGTAAATACACTCTTTCATCGTTTATTCAAGATTTTAGATTAGTCCTTTTGGTAGGGAGACCTTTACTCACAAGGTAAGACTTCTAAG
TGTGTATCTAAATAAGTTGGTTGGAAAACGAAAAAGAAGAACATTTTGTGAAAGAAACTTGGGGGCAACTGCAAAATTGATGACTGTTTTGACTTTTGTG
AGCATGGAATACGAATTTCTTTACTCGTAAACCTTTGGTACTAAACGAAAGAAACATAAACCAACTCCATAGGTAGACCTGACCACATGTGAAACTAAGA
AAAAATTTATCAAACGAGTGATTTGATTTCATTCTTCCTTGCAATATGAACTTGGAAATAAGATTGAAGCTCAACTTTATTTTTTTTGGACAAAATCTAT
CACACCAGATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.931112
Expected error %
0.426343
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0094F12
Clone
Clone name
hba-94f12
LE_HBa0094F12
C03HBa0094F12
P094F12
Clone type
BAC
Contamination
none
Estimated length
71,761
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found