Clone Read LE_HBa0094G18_T7_27587

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0094G18_T7_27587
Primer
T7
ID from Seq. Facility
LE_HBa_094_G18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
724 trimmed for vector and quality, 813 raw
Sequence
>LE_HBa0094G18_T7_27587 (raw untrimmed)
CTGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTATAGAGGTGGATTCCTACATCCCTTACTTGGAATTATTTAAAAAGCCACTT
CCCCTACTTGCTTCTTAACAATATTGAGTTACAACGCAAAATCTGCTTCTGACCTTTTATACTGCTCTTTTTGATTGAAGATATCTGAAGGGGTGTCTCG
GTTTGTTGCAACACAAGGTCCACTAGCACACACCTTTGAAGACTTCTGGGAAATGATAATCCAGCAACGCTGTCCTGTCATTGTGATGCTTACACGATTG
GTTGACAATTACAAGGTATTCAATTGTTTAGACTAAGGTATACTTGCTTTGCAACCAAAATAAGTAAACATTTTATGACTATAGTCTGATCTATAATTTT
CTTTATGGAAGAGAGAACCGACACTTTTACCTTTTTCAGTTTCTTCATTTGTAACCCCCTCCCACACACACACAGAAGTAGACCTGGCATTTTTATGCAT
TGAAGAAGTTGCAAATGAATCTTTGTTGGGTCTTGAACTTTTATCTTAAGATACAAAACCGAAGCCAGGAAGCCTGGCATGGAAAGGCTCAAGAAAAAAG
TATCTTACAAATATACCTTTCATGCGTTCGCGCATAGAGCTTTGGTATAGCACTAAGGGCGCTACACGCTATGTTTGGGTTAGCGCTCGTCATGTGTTTG
AACTTTGTTGCGGACAAAAGGTTGGAATTTAAGTGAGGAATAAAAGAGGTTTGACCATTACTCAAGGAGTTTCGAACTATTTGCTCATGGACCTGGAAAA
ATTTTCTGGTTAT
>LE_HBa0094G18_T7_27587 (trimmed for quality and cloning vector)
AGCTTTATAGAGGTGGATTCCTACATCCCTTACTTGGAATTATTTAAAAAGCCACTTCCCCTACTTGCTTCTTAACAATATTGAGTTACAACGCAAAATC
TGCTTCTGACCTTTTATACTGCTCTTTTTGATTGAAGATATCTGAAGGGGTGTCTCGGTTTGTTGCAACACAAGGTCCACTAGCACACACCTTTGAAGAC
TTCTGGGAAATGATAATCCAGCAACGCTGTCCTGTCATTGTGATGCTTACACGATTGGTTGACAATTACAAGGTATTCAATTGTTTAGACTAAGGTATAC
TTGCTTTGCAACCAAAATAAGTAAACATTTTATGACTATAGTCTGATCTATAATTTTCTTTATGGAAGAGAGAACCGACACTTTTACCTTTTTCAGTTTC
TTCATTTGTAACCCCCTCCCACACACACACAGAAGTAGACCTGGCATTTTTATGCATTGAAGAAGTTGCAAATGAATCTTTGTTGGGTCTTGAACTTTTA
TCTTAAGATACAAAACCGAAGCCAGGAAGCCTGGCATGGAAAGGCTCAAGAAAAAAGTATCTTACAAATATACCTTTCATGCGTTCGCGCATAGAGCTTT
GGTATAGCACTAAGGGCGCTACACGCTATGTTTGGGTTAGCGCTCGTCATGTGTTTGAACTTTGTTGCGGACAAAAGGTTGGAATTTAAGTGAGGAATAA
AAGAGGTTTGACCATTACTCAAGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.965712
Expected error %
0.611184
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g71860.2 Score 82 E Value 4e-16 Identity 23.30% Align. Length 149bp (20.58%) Frame 1
68414.m08304 protein tyrosine phosphatase 1 (PTP1) identical to protein tyrosine phosphatase 1 GI:3170531 from [Arabidopsis thaliana]; contains Pfam profile: PF00102 protein-tyrosine phosphatase
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g71860.1 Score 82 E Value 4e-16 Identity 23.30% Align. Length 149bp (20.58%) Frame 1
68414.m08305 protein tyrosine phosphatase 1 (PTP1) identical to protein tyrosine phosphatase 1 GI:3170531 from [Arabidopsis thaliana]; contains Pfam profile: PF00102 protein-tyrosine phosphatase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT35563.1| Score 82 E Value 2e-14 Identity 25.50% Align. Length 140bp (19.34%) Frame 1
protein tyrosine phosphatase; PTP [Phaseolus vulgaris]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_974127.1| Score 82 E Value 2e-14 Identity 23.30% Align. Length 149bp (20.58%) Frame 1
protein tyrosine phosphatase 1 (PTP1) [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0094G18
Clone
Clone name
hba-94g18
LE_HBa0094G18
P094G18
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found