Clone Read LE_HBa0006J14_SP6_2762

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006J14_SP6_2762
Primer
SP6
ID from Seq. Facility
LE_HBa_006_J14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
676 trimmed for vector and quality, 972 raw
Genbank Accession
Sequence
>LE_HBa0006J14_SP6_2762 (raw untrimmed)
AAAAAAAAAAGGTTTTTCTTTTCACTGTGTACATANNNGNNNANGGNNNNANNTTGGGNCNANNANNNNNNANNNNNNNNCTGNNCGTCAGCTTTTAAGG
GGGATTTNTTAGGAATGAAAAAATGTTNNTAAACA
TTTTCTGTTACTTTAGCCATAGGAATTCTATCTTGTTTCTTGTTCTGTTCGGGATAAATGTCATG
GAACACAGACATTGCTTGTATGTATATGTTTTTATGACACTTCTGCTTCTTATTGTGGTTCAATTTCACAGATTCCTTTTGAAATCAATGCAGGCATTCT
CACTGGATTTTAACTTAAGATCACACATGAAAACACACTCCCAGGAGAACTATCATATTTGCCCGTATCCAGAATGTGGAAAGCGATATGCACATGAGTA
CAAGCTTAAAAATCATATTTCATCTACTCACCAGAAGGTTTGTGATTTGCTCTATCGTCCTTGTCTTGACCAGGATATACTTATACAGACTTTATGAACT
TTTTCCATCTTTGATCACAAACAAGGTGCTAAATGTCCTAAATGTTTCATCAATAATCACTTGCTGTTTCTTCCCAACTTTGGATCGTTAACATTATTTA
AGCCAATTCTTCTTTGTAAACCAGACTGAACTTTAATTTCATATGCACATGTTTACTTTCTTTGAACATATTTATCTTTAAGATTTTCCTTGCCCATAAA
TTCCAATATGCTGGAGGAGCTCTGTTAGATATCTTTATTGGTATTTTTTTATGTTGCATACCCATTACTCCTTCATTTCCTTGTTAAAGATGTTTTAAAG
GAAAAAAGATGCTATTCAATGTGTAATCTTTTCCTCAAAATAAATGTGGATAGAATTTTTATCGCCTGTTAATGGTGGGCTCAGTCACTTTTAAGTATAC
TGCGTAGAATAGAAGTTGACTCCAAACCAAACTCACATAAAAGAAAGAATTATGTAGGGATTAATGTTCTTT
>LE_HBa0006J14_SP6_2762 (trimmed for quality and cloning vector)
TTTTCTGTTACTTTAGCCATAGGAATTCTATCTTGTTTCTTGTTCTGTTCGGGATAAATGTCATGGAACACAGACATTGCTTGTATGTATATGTTTTTAT
GACACTTCTGCTTCTTATTGTGGTTCAATTTCACAGATTCCTTTTGAAATCAATGCAGGCATTCTCACTGGATTTTAACTTAAGATCACACATGAAAACA
CACTCCCAGGAGAACTATCATATTTGCCCGTATCCAGAATGTGGAAAGCGATATGCACATGAGTACAAGCTTAAAAATCATATTTCATCTACTCACCAGA
AGGTTTGTGATTTGCTCTATCGTCCTTGTCTTGACCAGGATATACTTATACAGACTTTATGAACTTTTTCCATCTTTGATCACAAACAAGGTGCTAAATG
TCCTAAATGTTTCATCAATAATCACTTGCTGTTTCTTCCCAACTTTGGATCGTTAACATTATTTAAGCCAATTCTTCTTTGTAAACCAGACTGAACTTTA
ATTTCATATGCACATGTTTACTTTCTTTGAACATATTTATCTTTAAGATTTTCCTTGCCCATAAATTCCAATATGCTGGAGGAGCTCTGTTAGATATCTT
TATTGGTATTTTTTTATGTTGCATACCCATTACTCCTTCATTTCCTTGTTAAAGATGTTTTAAAGGAAAAAAGATG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.939103
Expected error %
0.307299
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g06634.1 Score 94 E Value 5e-20 Identity 27.20% Align. Length 146bp (21.60%) Frame 1
68417.m01050 zinc finger (C2H2 type) family protein contains Pfam PF00096: Zinc finger, C2H2 type
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAA75685.1| Score 107 E Value 3e-22 Identity 31.30% Align. Length 146bp (21.60%) Frame 1
WREBP-2 [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_849323.1| Score 94 E Value 2e-18 Identity 27.20% Align. Length 146bp (21.60%) Frame 1
zinc finger (C2H2 type) family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006J14
Clone
Clone name
hba-6j14
LE_HBa0006J14
P006J14
Clone type
BAC
Contamination
none
Estimated length
157,947
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found