Clone Read LE_HBa0006J14_T7_2763

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006J14_T7_2763
Primer
T7
ID from Seq. Facility
LE_HBa_006_J14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
795 trimmed for vector and quality, 998 raw
Genbank Accession
Sequence
>LE_HBa0006J14_T7_2763 (raw untrimmed)
GGGCTTACTCGGAACCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTAAAAAATGAAAACACTTAGTCCTTTTAAAGAAAATCCAATAATA
AACTCAACTTTACTTATATACTTAGTAATATCGTTTTTATGGGAGATTCTCTAACAGACAACCATCACTATAAGCCTAAGTGGTGATACAACGTCTTCCT
CACGCTGTCAAAACTGTCCTATACTTTGTCGTTGCATAGAACTACTTAACTTAGTGGATCCACTAGCTTAACTACTTGATCATCTAAAAAGTATGGTCTG
TTAATACCTATGATGACTATATAATTTTAATGGATACTTGAGTTAATATGAACTCTTATCCCCGCATCGATGCTCAGTGCTACTGTCAAAATATACTTTA
GCTCATGTTTTTAAAACAACTTCTTTCTTTGGGTTGATATTATTGCTTAACACTTAGCTTTAGAAAACTCTCTTGGAATCAGTGTTCCCTTTTTCTTGCT
CAAAACTCTTTGGAAATCTTAGTATCCTCTTAACTTAAATGTAAAAACAATTGTAACTCATAGGAACTTATATGAAAGAGTGGGGAAGGAATGGGGTGAA
CTAGCGTCCTCTGCGCTATGAGAGGCGTGGGGCGCCAGGCCCCACACTTCAGAGGGCAAGCTGGGACACTATGGCTGGTGTGGCGCCCCAGGGCCCTACG
AACATTTTAAATTTTCTCCTCCCGTTTTCATCTCTAAACCCTCTAAACTTCCATGGATCTTTCTTTGAACACTTAGGGATCATTAGTACCTTTAATATCC
AATAAATTTGACTCAAAAAACAACTTGGTAACAGATCCAATTCAAACTTGTGCATGCCACAACTCATCGAACAGAAATTAAATTAAGTTGGGGGGGGGGT
GAATTAACCCTAAACATAAAATTCTAATATCTTGGAAGGGAGTATCCTATACATTTCCACCTAAAAACTTTGTATCCATTGGATATTCTTACTTTTTT
>LE_HBa0006J14_T7_2763 (trimmed for quality and cloning vector)
AGCTTGTAAAAAATGAAAACACTTAGTCCTTTTAAAGAAAATCCAATAATAAACTCAACTTTACTTATATACTTAGTAATATCGTTTTTATGGGAGATTC
TCTAACAGACAACCATCACTATAAGCCTAAGTGGTGATACAACGTCTTCCTCACGCTGTCAAAACTGTCCTATACTTTGTCGTTGCATAGAACTACTTAA
CTTAGTGGATCCACTAGCTTAACTACTTGATCATCTAAAAAGTATGGTCTGTTAATACCTATGATGACTATATAATTTTAATGGATACTTGAGTTAATAT
GAACTCTTATCCCCGCATCGATGCTCAGTGCTACTGTCAAAATATACTTTAGCTCATGTTTTTAAAACAACTTCTTTCTTTGGGTTGATATTATTGCTTA
ACACTTAGCTTTAGAAAACTCTCTTGGAATCAGTGTTCCCTTTTTCTTGCTCAAAACTCTTTGGAAATCTTAGTATCCTCTTAACTTAAATGTAAAAACA
ATTGTAACTCATAGGAACTTATATGAAAGAGTGGGGAAGGAATGGGGTGAACTAGCGTCCTCTGCGCTATGAGAGGCGTGGGGCGCCAGGCCCCACACTT
CAGAGGGCAAGCTGGGACACTATGGCTGGTGTGGCGCCCCAGGGCCCTACGAACATTTTAAATTTTCTCCTCCCGTTTTCATCTCTAAACCCTCTAAACT
TCCATGGATCTTTCTTTGAACACTTAGGGATCATTAGTACCTTTAATATCCAATAAATTTGACTCAAAAAACAACTTGGTAACAGATCCAATTCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.961086
Expected error %
1.17809
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006J14
Clone
Clone name
hba-6j14
LE_HBa0006J14
P006J14
Clone type
BAC
Contamination
none
Estimated length
157,947
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found