Clone Read LE_HBa0094J12_T7_27719

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0094J12_T7_27719
Primer
T7
ID from Seq. Facility
LE_HBa_094_J12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
723 trimmed for vector and quality, 766 raw
Sequence
>LE_HBa0094J12_T7_27719 (raw untrimmed)
CCTGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTAACCATGAAAATTCAAGTGACCATTTACGTTTGTGCCAAAGCCATGAATC
ATCTACAATTTCTTCTTTAATGCATTGCAATGAATGCAAAGGGAAGTTTCTTTTTATCATTTTTACTTCAACAACGACTTGATTTGATTCAATTTTATCA
TAAATCTTGCAATAATTATCTCTAAACACAAGAGAATAACCATTTTCCATGAGTTGACCAACAGTAAGCAAATTTTCTTCCAAGTCAGGAACATAAAGAA
CATCATGAACTTGCTTACCACATCCTTTCATGTTGATCCAAATAGTACCTTTACCTTTCACATCAACTAAGGCTCCATTCCCCATCTTCACTTTAGTAGT
GATGCTATTATTAATTGAGAGGAAAGTCTTTTCATTTACAGTCATGTGATTACTACAACCACTATCAACATACCATTCATTGCTTTTTCTTGAAGCATCA
GATTTAGAAGCAAAGAAAAGATTTTCTTCCCTTTCTTCCTCATGTTTTTCACAAAAAATTTCTTGCTCCTATTTCTTGTGCCAAGAATCCTTTTTAACGT
GGCCAAACTTCTTGCAAAAGTTACATTGGGGCTTGCCTTTGTGCCAACATTTTTCAACATTGTGATTAGTCTTTTTGCAAACTTTATAAAAAAAAATGAG
TTTTTTCTCACCTTTTTCTTCAACCTTCTTGGAAGAACCATCATGATCCTACTTCTTTTTTGGCTT
>LE_HBa0094J12_T7_27719 (trimmed for quality and cloning vector)
AGCTTTTAACCATGAAAATTCAAGTGACCATTTACGTTTGTGCCAAAGCCATGAATCATCTACAATTTCTTCTTTAATGCATTGCAATGAATGCAAAGGG
AAGTTTCTTTTTATCATTTTTACTTCAACAACGACTTGATTTGATTCAATTTTATCATAAATCTTGCAATAATTATCTCTAAACACAAGAGAATAACCAT
TTTCCATGAGTTGACCAACAGTAAGCAAATTTTCTTCCAAGTCAGGAACATAAAGAACATCATGAACTTGCTTACCACATCCTTTCATGTTGATCCAAAT
AGTACCTTTACCTTTCACATCAACTAAGGCTCCATTCCCCATCTTCACTTTAGTAGTGATGCTATTATTAATTGAGAGGAAAGTCTTTTCATTTACAGTC
ATGTGATTACTACAACCACTATCAACATACCATTCATTGCTTTTTCTTGAAGCATCAGATTTAGAAGCAAAGAAAAGATTTTCTTCCCTTTCTTCCTCAT
GTTTTTCACAAAAAATTTCTTGCTCCTATTTCTTGTGCCAAGAATCCTTTTTAACGTGGCCAAACTTCTTGCAAAAGTTACATTGGGGCTTGCCTTTGTG
CCAACATTTTTCAACATTGTGATTAGTCTTTTTGCAAACTTTATAAAAAAAAATGAGTTTTTTCTCACCTTTTTCTTCAACCTTCTTGGAAGAACCATCA
TGATCCTACTTCTTTTTTGGCTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.926996
Expected error %
0.581444
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP46257.1| Score 155 E Value 1e-36 Identity 12.90% Align. Length 635bp (87.83%) Frame 2
putative polyprotein [Oryza sativa (japonica cultivar-group)] ref|XP_470160.1| putative polyprotein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38786.1| Score 147 E Value 2e-34 Identity 12.80% Align. Length 632bp (87.41%) Frame 2
putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0094J12
Clone
Clone name
hba-94j12
LE_HBa0094J12
P094J12
Clone type
BAC
Contamination
none
Estimated length
52,184
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found