Clone Read LE_HBa0180P04_SP6_277408

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0180P04_SP6_277408
Primer
SP6
ID from Seq. Facility
LE_HBa_180_P04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
137 trimmed for vector and quality, 1076 raw
Sequence
>LE_HBa0180P04_SP6_277408 (raw untrimmed)
TTATTCATCACTTCCAGACCTTAATTGCATCCTCCCACTTACACTTACTAATACTAATCAACTAATACCCCTTTTTAAACCATATGTTTATAATTTTAAA
AAAATCTCTCTACACATATTTATCAAAACCTATTCACAATATCAAGAGACATACTTTCCTTTTGTGAAATAACTGACACCATCTGGCCTGTACAATATCT
CTAGCCCAAGGAAATAAT
GCAATCTTCCTAAATCTTCTATTCTGAATTTCTCATGCAAGAAGAGCTTCAAAGATTCAATCTCCTTCATATCACTACCAGT
TAGGATAATGTCATCAACATATACAGCCACAAACACCAAGGAGTTACCATTTTTCTTGTAAAACAGTGAGAAATCACTTTCTGAATGAACATAACCTTTC
GAGCATATCACTATTATCTAAATTCTCATACCAACTGTCTACTATCTTGCTTCAAACCATACAATGGACTTCTTCAATTTGCTTACCATATTCTCTGCTG
TTCAACTATCAATTCCTTGGAGGGTAATGTCCAAACTAACATCTCTATCTTCTACTAATCTACTATGCTTTATACTAACCTTACTTGTCTTCACAACTTC
ATCTTCATTAAACTATTCTCCTACTTTACCAGTCTAAAACTCTTCTCCATTACCTTCCTCTTATCATCTCAATTTTCACCAATCCATATACAAATTCTTT
CTTAAAATTTCTCTCATATTCTAATCTATCTCACATCCTACCCTCCCTTTCTATCTCACGACACCCCATATCCTCACATACAAAATCATTCCTTAAGACT
CTATCACACTTATTAATTATCCTACTATCTATAACACTCTTCCCACCTTCTTTCTCTATTCTTCACCCATAACCCTCTTCCACTATATTTTACCATACCT
TTTAATCTTAATCCTTTACCGTATCAACTTTACTCCATCTCAACATATACAATTCTTCAAACACTCTGTTACTTTCACCTATTTAACTAACAATTATCGT
ACCTTCACCAATTAACAACTAATCCAATCTCCACACTAATTATATCTTCTACAAACTAATTTATTCATCCTTTCAA
>LE_HBa0180P04_SP6_277408 (trimmed for quality and cloning vector)
GCAATCTTCCTAAATCTTCTATTCTGAATTTCTCATGCAAGAAGAGCTTCAAAGATTCAATCTCCTTCATATCACTACCAGTTAGGATAATGTCATCAAC
ATATACAGCCACAAACACCAAGGAGTTACCATTTTTC

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.906013
Expected error %
1.52994
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0180P04
Clone
Clone name
hba-180p4
LE_HBa0180P04
C12HBa0180P04
P180P04
Clone type
BAC
Contamination
none
Estimated length
51,720
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found