Clone Read LE_HBa0185H22_SP6_277841

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0185H22_SP6_277841
Primer
SP6
ID from Seq. Facility
LE_HBa_185_H22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
10 trimmed for vector and quality, 970 raw
Sequence
>LE_HBa0185H22_SP6_277841 (raw untrimmed)
GGGGNNNNNCATGGACTTGATCTCAGCTTGCTGCCTGCAGGTCGACTCTAGAGGATCCCCNGGGTACCGAGCTCGAATTCGCCCTATAGTGAGTCGTATT
ACAATTCACTGGCCGTCGTTTTACCACGTCGTGACTGGGAAAACCCCTGGCGGTTACCCCACTTAATCGCCTTGCCGCCCATTCCCCTTTCCCCAGCTGG
GGTAATAGCGAAAAAGGCCGCCACCGATTGCCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCT
GTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCG
AACCCCTTGCGGCCGCATCGAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGCGATGAGCTCGGACTTCCATTGTTCATTCCACGGACAAAA
ACAGAGAAAGGAAACNACAGANGCCNAAAAGCTCGCTTTCAGCACCTGTCGTTTCCTTTCTTTTCAGAAGGTATTTTAAATAAAAACATTAAGTTTTGAC
CAACAAGAACGGGAACTCCTTAAACCCGAAAATTTTTATAAATAGCGAAAACCCGCGAGGTCGCCCCCCCGTAACCCTGTCGGAATCCCGGAAAGGACCC
GCAAAGGGATAATGATTATACATCCTCATACCCCAACCTGCGTTGAGGCGTCTTAGCCAGTTCAATAATCAATTGAGACCCAGGAAGACAAGTTATTGAT
TTTTCTCGACATCACCTGAGAAAACCATTACAACATAAAAAATAATGAAACCTCATATAGAGTTCTATAGTACTGATGTTGAACCTATGATGTTTGTAAT
CGGAAAAGGAAGGTACTTCAACCTCAACCCTAATATAATTGATATTCTCGATCTACTATATTTACCATTC
>LE_HBa0185H22_SP6_277841 (trimmed for quality and cloning vector)
CTCAGCTTGC

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
3' read, short insert
Quality trim threshold
14.5
Sequence entropy
not recorded
Expected error %
5.34332
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0185H22
Clone
Clone name
hba-185h22
LE_HBa0185H22
P185H22
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found