Clone Read LE_HBa0094L23_SP6_27836

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0094L23_SP6_27836
Primer
SP6
ID from Seq. Facility
LE_HBa_094_L23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
585 trimmed for vector and quality, 787 raw
Sequence
>LE_HBa0094L23_SP6_27836 (raw untrimmed)
GCTTGCCTCCCAGGCTTCACTTTGCCTCCCACCTATATATATTAAGTATAGAAAAATATGAGGTCAGTAAAAACCATGTACTAAGTATGACATATGCAAA
ATCATGCAAAATGGAACGTTTTAGTAGAAATAAACTTTCATGCCAATTAAGTTAAAATAGTAGAAGAATCATCATTTAGAATTAAGGACTTCACATAAGT
GCCCTTTCCCAAGAAGACTTACGAGTTACAAAAAGTGCAATCTGAGAGTAGCATCTCATACTAATACTCCCACTTTATGCTCTTTAAGGATTCCATGAGG
TTAGATACACTACATTCACCATTCATAGATTTAATTATACAAGACATAACCTTAGCATGGTTTCTTAACATTAGAGATTAAGTCACATAACTCCATTTAC
AACACTTGATAACTCATTCATACACTTCATATAAAACACACCAAGACTCCCCTTTCGGAATGTATACTTGTGCAATGCACCCATAGTGTCCCATACCACT
ACCTACCCTAAGTAGTACACTCTTTGAGGAGACTTAGTTCATTCATTCTTTTGTGGGGGATGAATTCGACCGACATAGACCATGAGAACTCGTCATGGAA
TCTCGATATTAGCCTTATCCGATGAGGGATCCCTACTTGCCTATGGTAGGGTTCTTCTCCTAGCCTTTTCATGGATTCTCCAATCCCTACACCTATGCCG
GGCGCATAGTTTAAGGGATAAAGGAGATTGCTTTTAAAGAATTTCACTCCTCGCCTCACGAGCCAATACTCATATCCAAGAAGGTAC
>LE_HBa0094L23_SP6_27836 (trimmed for quality and cloning vector)
CACCTATATATATTAAGTATAGAAAAATATGAGGTCAGTAAAAACCATGTACTAAGTATGACATATGCAAAATCATGCAAAATGGAACGTTTTAGTAGAA
ATAAACTTTCATGCCAATTAAGTTAAAATAGTAGAAGAATCATCATTTAGAATTAAGGACTTCACATAAGTGCCCTTTCCCAAGAAGACTTACGAGTTAC
AAAAAGTGCAATCTGAGAGTAGCATCTCATACTAATACTCCCACTTTATGCTCTTTAAGGATTCCATGAGGTTAGATACACTACATTCACCATTCATAGA
TTTAATTATACAAGACATAACCTTAGCATGGTTTCTTAACATTAGAGATTAAGTCACATAACTCCATTTACAACACTTGATAACTCATTCATACACTTCA
TATAAAACACACCAAGACTCCCCTTTCGGAATGTATACTTGTGCAATGCACCCATAGTGTCCCATACCACTACCTACCCTAAGTAGTACACTCTTTGAGG
AGACTTAGTTCATTCATTCTTTTGTGGGGGATGAATTCGACCGACATAGACCATGAGAACTCGTCATGGAATCTCGATATTAGCC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.948707
Expected error %
0.96977
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0094L23
Clone
Clone name
hba-94l23
LE_HBa0094L23
P094L23
Clone type
BAC
Contamination
none
Estimated length
122,389
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found