Clone Read LE_HBa0196B23_SP6_278832

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0196B23_SP6_278832
Primer
SP6
ID from Seq. Facility
LE_HBa_196_B23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
388 trimmed for vector and quality, 833 raw
Genbank Accession
Sequence
>LE_HBa0196B23_SP6_278832 (raw untrimmed)
GCCGGCTGGGTGGTCCGGTAGAGTTTGGGGCCGCCATGGATGCGCTTTTGATGCTGCTGGTCGTGGACGCTGTGCAACTGGGGACTGTGGTGGTTCACTT
TTTTGTAATGGAATTGGTGGTACCCCTCCGGCTACTCTCGCTGAGATTACTCTGGGCAATGAACAGGATTTCTACGATGTGAGTCTCGTAGATGGCTACA
ATCTCGCCATCTCTGTAACTCCAGTCAGAGGCAAAGGTGAGAAACATGCCTGATAATATCTAAATGACTCATTTGTCCTTGATTAGTTCTTCGATACTTC
CTTTTTTTCTTCTACTTTCGTAACAGGGTTACTTTCGTCATTACGTTAATTATTACCCCTTTCCCCTTTCTTTTCTCGTGTATTAAATCAAACAATACTT
TTCGCTCCTTCTGTTGATTAAATGATTTTTTCACCTAATTATTGTGAGTTACTATTCCTCTCGTTATTAGTTAATTGGAGATCTTCTGGGATCTAAAATT
TCGTGCTATTGAGGATTTCGTCCCTTTGTTTTTACATGTAAATTCTTCTTCGCTGGTTGTGTGAATGACTCATACTCTATCGTGTCCCAGATAGGTTCTT
TCTATTTCGTTTCCTTTTCTTCAATTTCCTTATTGGTTCCCAACACTTCTGTGTTTTCTTTTCAATTTTTCCCTGAATTTTCTATTTCTTCATACTTATT
TTCCTCTCCCCTATACCTTTCTCATTATCCTATTCTTTTTCTTGGTCTTACTTATAAATTTCTCTTTATTCTTTCGCTCCTCTTTTTTTTTTTGTTAACC
TCCTATATCCCTTTTACAATTTTTTTTTTTTTA
>LE_HBa0196B23_SP6_278832 (trimmed for quality and cloning vector)
GCCGGCTGGGTGGTCCGGTAGAGTTTGGGGCCGCCATGGATGCGCTTTTGATGCTGCTGGTCGTGGACGCTGTGCAACTGGGGACTGTGGTGGTTCACTT
TTTTGTAATGGAATTGGTGGTACCCCTCCGGCTACTCTCGCTGAGATTACTCTGGGCAATGAACAGGATTTCTACGATGTGAGTCTCGTAGATGGCTACA
ATCTCGCCATCTCTGTAACTCCAGTCAGAGGCAAAGGTGAGAAACATGCCTGATAATATCTAAATGACTCATTTGTCCTTGATTAGTTCTTCGATACTTC
CTTTTTTTCTTCTACTTTCGTAACAGGGTTACTTTCGTCATTACGTTAATTATTACCCCTTTCCCCTTTCTTTTCTCGTGTATTAAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.974644
Expected error %
0.180542
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g73620.1 Score 142 E Value 5e-35 Identity 25.40% Align. Length 239bp (61.60%) Frame 3
68414.m08523 thaumatin-like protein, putative / pathogenesis-related protein, putative strong similarity to SP|P50699 Thaumatin-like protein precursor {Arabidopsis thaliana}, pathogenesis-related group 5 protein [Brassica rapa] GI:2749943; contains Pfam profile: PF00314 thaumatin family
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g18250.1 Score 140 E Value 2e-34 Identity 25.80% Align. Length 239bp (61.60%) Frame 3
68414.m02276 thaumatin, putative identical to SP|P50699 Thaumatin-like protein precursor {Arabidopsis thaliana}; strong similarity to pathogenesis-related group 5 protein GI:2749943 from [Brassica rapa]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAB95118.1| Score 144 E Value 1e-33 Identity 25.80% Align. Length 239bp (61.60%) Frame 3
pathogenesis-related group 5 protein [Brassica rapa] pir||T14428 thaumatin-like protein - turnip
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM62907.1| Score 142 E Value 3e-33 Identity 25.40% Align. Length 239bp (61.60%) Frame 3
thaumatin-like protein [Arabidopsis thaliana] dbj|BAC42848.1| putative thaumatin [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0196B23
Clone
Clone name
hba-196b23
LE_HBa0196B23
C03HBa0196B23
P196B23
Clone type
BAC
Contamination
none
Estimated length
83,370
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found