Clone Read LE_HBa0196C17_SP6_278850

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0196C17_SP6_278850
Primer
SP6
ID from Seq. Facility
LE_HBa_196_C17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
593 trimmed for vector and quality, 901 raw
Genbank Accession
Sequence
>LE_HBa0196C17_SP6_278850 (raw untrimmed)
AGGCATTGATATCAGCTTGGAGTATAGGAGGTCAGATACCGGGAGAACCAGCCACAGATGAGATTCGTGAAGAAATGGCTCAGATGAGAACTAAGCATGG
GTTGGTATTAAAGAATATCACTGGGGCTGCAGAAAAGATAGATGTTGTCAACTACATGTCGAAACCACCGCCACCTAATGATGAATGCAATTATGCGGAG
GACACCTATGAAGTAAATGAGCAGACAGGGGGTTTCCGACCGAGCGCCCAAGTCTCAAATCATGATAATTGGCACCAAGGTCAAGGGAACTAAGGTCTGA
TCTATGGTAAATACAACCGTGAGGGTCATTATGTCAGAGATGGAAACTACAACCGCGACAATAACTTCAACTGGGGTAACTACGATAACACAAATGATAG
GAATGGGCCCTATGTCCCTCCTCAAAATTATGAAGTTATTCCTAGGAATGGTGGAGATAGTATGGCGCGAGTTGAGGATATGTTGCACAAAATGATGAGG
AGGTTCGATGCTAGTGATGAGCACATTAAAGAGTTAAGGTGCGACTTAGCAAGTATTGGGATAAAAGTCGATACACAAGAATATCTATTAAGCAGATCGA
GTTGCAAGTGGCCCAATTATCTGCGACAGTGAACACACGGCAACGGGGCACTCTTCCTAGCACCACTGTCCAAAATCCCAAAAATGATACCCACTGGTAG
GAAAATCCTACCTCGAGATGGTAAGCCAACCATTGAACCCCCCATGCCATCTAATGGAGGAAAAGGGAAGAAAAGATTATTCTTAAGGGTGTTAAAGGCT
AATGGTTAAATAAAAATAATTCAATGGTAAAAAATCCCAAGTCCCTTTAAAAGGTAATTCCCTTGCTATAAACCATCTCCAACTTTCCTCCTCCAAAAAT
T
>LE_HBa0196C17_SP6_278850 (trimmed for quality and cloning vector)
TCAGCTTGGAGTATAGGAGGTCAGATACCGGGAGAACCAGCCACAGATGAGATTCGTGAAGAAATGGCTCAGATGAGAACTAAGCATGGGTTGGTATTAA
AGAATATCACTGGGGCTGCAGAAAAGATAGATGTTGTCAACTACATGTCGAAACCACCGCCACCTAATGATGAATGCAATTATGCGGAGGACACCTATGA
AGTAAATGAGCAGACAGGGGGTTTCCGACCGAGCGCCCAAGTCTCAAATCATGATAATTGGCACCAAGGTCAAGGGAACTAAGGTCTGATCTATGGTAAA
TACAACCGTGAGGGTCATTATGTCAGAGATGGAAACTACAACCGCGACAATAACTTCAACTGGGGTAACTACGATAACACAAATGATAGGAATGGGCCCT
ATGTCCCTCCTCAAAATTATGAAGTTATTCCTAGGAATGGTGGAGATAGTATGGCGCGAGTTGAGGATATGTTGCACAAAATGATGAGGAGGTTCGATGC
TAGTGATGAGCACATTAAAGAGTTAAGGTGCGACTTAGCAAGTATTGGGATAAAAGTCGATACACAAGAATATCTATTAAGCAGATCGAGTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.972318
Expected error %
0.172166
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 135 E Value 9e-31 Identity 13.90% Align. Length 524bp (88.36%) Frame 2
putative reverse transcriptase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0196C17
Clone
Clone name
hba-196c17
LE_HBa0196C17
P196C17
Clone type
BAC
Contamination
none
Estimated length
103,134
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found