Clone Read LE_HBa0006L06_SP6_2842

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006L06_SP6_2842
Primer
SP6
ID from Seq. Facility
LE_HBa_006_L06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
686 trimmed for vector and quality, 956 raw
Genbank Accession
Sequence
>LE_HBa0006L06_SP6_2842 (raw untrimmed)
AAAAAAAAAAGGGGTTTCCGCCCTCTATTGACACANNNANNANNNNGNATGACCNTTNATGTGCAGTCTGACTGACTATTCGTGTAAAGATCCTAACTTG
TTGTTTTTTGGGCTTTATGAACAGGCTCATTTCAAACTTTTCTTTGACATTTTGCATTGTATCAGTTCTTACTGGTATATCAACATTGTATAACCAGGCC
CTAACTTTTGGTGGGCCTGTTACTATTGTTTGTGGATGGCCCATAATTGGATTAATGACACTTATTGTGGGCCTTTCTATGGCTGAAATATGTTCTGCTT
ATCCAACTTCTGCTGGGCTTTATTATTGGAGTGCTAAATTGGCTGGAAACAAGATTGGCCCATTTGCTGCTTGGATTACTGGCTGGTAAGGCCCATTTCC
TTTTCCTCTCTAGTTAAATGTTAAATTTAACATTTTGTGATTTTTCATATTTTTTAGTAATATGTTCGAGAAGATAGGAAGGTGCGGAGGTCGAGGGAGG
GTAGAAGGGTAGTAGGTAGTTTGTCGTATTTTCACATGGGAGAGGAAGGGTTTTGTCTCATCTTCTCATTGTTTATAATAGTCATTTCGATAAATTTTAA
AGTGATAGAAAATAAACTGCAATCATAAATAAAATATAACGAAAACATAACTTTATTGATAAACATCTTATGATTCTTCTTTCATAAGATATTTATTCAT
TATTTGAGGGTTGTTTGTGTCGTATTTCTCGAACTAAGGTAATTTAAATTTGATCTCCTTAGGAATATTCCATGAATTTGCGTAATATTCGAGATGCCCT
GTAAAGGGAAAATACTACTTTTTATTAGGCATGAACTAACTGGTTAAGAGTGAGTACCTTCTAAATACCTTATTTAAAGTTTAACACATCTTGAAAGTAC
ATTTAAAATGAAACTATTCTTTTAAGTTCACATAATTCCAGTATCTAATGTTTTTG
>LE_HBa0006L06_SP6_2842 (trimmed for quality and cloning vector)
ATGTGCAGTCTGACTGACTATTCGTGTAAAGATCCTAACTTGTTGTTTTTTGGGCTTTATGAACAGGCTCATTTCAAACTTTTCTTTGACATTTTGCATT
GTATCAGTTCTTACTGGTATATCAACATTGTATAACCAGGCCCTAACTTTTGGTGGGCCTGTTACTATTGTTTGTGGATGGCCCATAATTGGATTAATGA
CACTTATTGTGGGCCTTTCTATGGCTGAAATATGTTCTGCTTATCCAACTTCTGCTGGGCTTTATTATTGGAGTGCTAAATTGGCTGGAAACAAGATTGG
CCCATTTGCTGCTTGGATTACTGGCTGGTAAGGCCCATTTCCTTTTCCTCTCTAGTTAAATGTTAAATTTAACATTTTGTGATTTTTCATATTTTTTAGT
AATATGTTCGAGAAGATAGGAAGGTGCGGAGGTCGAGGGAGGGTAGAAGGGTAGTAGGTAGTTTGTCGTATTTTCACATGGGAGAGGAAGGGTTTTGTCT
CATCTTCTCATTGTTTATAATAGTCATTTCGATAAATTTTAAAGTGATAGAAAATAAACTGCAATCATAAATAAAATATAACGAAAACATAACTTTATTG
ATAAACATCTTATGATTCTTCTTTCATAAGATATTTATTCATTATTTGAGGGTTGTTTGTGTCGTATTTCTCGAACTAAGGTAATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945689
Expected error %
0.0932814
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g01170.1 Score 122 E Value 2e-28 Identity 21.10% Align. Length 260bp (37.90%) Frame 3
68415.m00026 amino acid permease family protein weak similarity to GABA permease [Emericella nidulans] GI:4972245; contains Pfam profile PF00324: Amino acid permease
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g01170.2 Score 71 E Value 5e-13 Identity 23.80% Align. Length 125bp (18.22%) Frame 3
68415.m00025 amino acid permease family protein weak similarity to GABA permease [Emericella nidulans] GI:4972245; contains Pfam profile PF00324: Amino acid permease
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_917593.1| Score 130 E Value 3e-29 Identity 22.60% Align. Length 260bp (37.90%) Frame 3
amino-acid permease like protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_917594.1| Score 128 E Value 2e-28 Identity 21.10% Align. Length 260bp (37.90%) Frame 3
putative amino acid or GABA permease [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006L06
Clone
Clone name
hba-6l6
LE_HBa0006L06
P006L06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found