Clone Read LE_HBa0095I03_SP6_28420

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0095I03_SP6_28420
Primer
SP6
ID from Seq. Facility
LE_HBa_095_I03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
744 trimmed for vector and quality, 906 raw
Sequence
>LE_HBa0095I03_SP6_28420 (raw untrimmed)
AGGCTTCCCATACGCTAGCATAGTCCAATTGAGACTGACTTTCACCTTTATTCTTTGCAAGATGAAGGTTTACATCAATTGGAGTCTTTGCCCTTTTAAA
ATTCAAAAAATTTGAATTTTTCAAGTATCTTTTGAATATAATGAGTTTGAGACAATTCTAGACCATTAGGAGTTTTAAGAATTTTAATTCCTAATATCAC
ATCAGCAACTCCTAAATCTTTCATATCAAACTTACTAGCGAGCATACGCTTTGTAGCTTTTATATTAGCAATGTCTTTGCTCATTATAAGCATATCATCT
ACATATAGTCATAAAATAACTTTCTGATTTGGAGTATCTTTAATGTAAACACATTTATCACATTCATTGATCTTAAATCCATTTGACAACATGGTTTAAT
CAAACTTTGCATGCCATTGTTTTGGTGCTTGTTTTAGTCCATAAAGTGACTTAATAAGTTTGCACACTTTCTTTTCTTTACCAGGAACTACAAAACCCTC
AGACTGTTCTATGTAAATTTCCTCTTCAAGCTCTCCATTTAAGAAGGTTGTTTTCACATCCATTTGATGAATTTCAAGACCGTATGCTACAGCTGGTGCA
ATTAACATCCGAATTGATGTAATCATAGTCACTGGCGAGTATGTGTCAAAATAATCAAGACCTTCTTTTTGTCTAAAACATTTGACATTAAGTCTTGCTT
TATATTTGTCAATAGTTCCATCGTCTTTCATCTTCTTTTTAAAGATCCATTTTGAACCCAAAAGTTTGTTCCCTGTAGGAAGATCAACCAACTTCCAGGT
ATGATTACTTAAGATTGATTCTATTTCACTATTAACAGCCTCCTTCCCAGAAGTTGAGTCGCTAAACAACATTGCTTCCTTGATGGTTGAAGCCTCCTTT
CAAGAG
>LE_HBa0095I03_SP6_28420 (trimmed for quality and cloning vector)
TTGAGACTGACTTTCACCTTTATTCTTTGCAAGATGAAGGTTTACATCAATTGGAGTCTTTGCCCTTTTAAAATTCAAAAAATTTGAATTTTTCAAGTAT
CTTTTGAATATAATGAGTTTGAGACAATTCTAGACCATTAGGAGTTTTAAGAATTTTAATTCCTAATATCACATCAGCAACTCCTAAATCTTTCATATCA
AACTTACTAGCGAGCATACGCTTTGTAGCTTTTATATTAGCAATGTCTTTGCTCATTATAAGCATATCATCTACATATAGTCATAAAATAACTTTCTGAT
TTGGAGTATCTTTAATGTAAACACATTTATCACATTCATTGATCTTAAATCCATTTGACAACATGGTTTAATCAAACTTTGCATGCCATTGTTTTGGTGC
TTGTTTTAGTCCATAAAGTGACTTAATAAGTTTGCACACTTTCTTTTCTTTACCAGGAACTACAAAACCCTCAGACTGTTCTATGTAAATTTCCTCTTCA
AGCTCTCCATTTAAGAAGGTTGTTTTCACATCCATTTGATGAATTTCAAGACCGTATGCTACAGCTGGTGCAATTAACATCCGAATTGATGTAATCATAG
TCACTGGCGAGTATGTGTCAAAATAATCAAGACCTTCTTTTTGTCTAAAACATTTGACATTAAGTCTTGCTTTATATTTGTCAATAGTTCCATCGTCTTT
CATCTTCTTTTTAAAGATCCATTTTGAACCCAAAAGTTTGTTCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.933591
Expected error %
0.141954
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 154 E Value 6e-38 Identity 11.70% Align. Length 707bp (95.03%) Frame 3
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89783.1| Score 328 E Value 2e-98 Identity 83.30% Align. Length 702bp (94.35%) Frame 2
putative retrovirus-related pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38766.1| Score 280 E Value 3e-77 Identity 68.50% Align. Length 741bp (99.60%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0095I03
Clone
Clone name
hba-95i3
LE_HBa0095I03
P095I03
Clone type
BAC
Contamination
none
Estimated length
101,046
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found