Clone Read LE_HBa0095I03_T7_28421

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0095I03_T7_28421
Primer
T7
ID from Seq. Facility
LE_HBa_095_I03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
878 trimmed for vector and quality, 926 raw
Sequence
>LE_HBa0095I03_T7_28421 (raw untrimmed)
TTAACCTGGGACCCGGGGGTACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGCACTGTATTCACAGTTAGTAGTGATGCCTCCAGTTAAAACAAAA
GAACATTTAGATCCATCCTTGAGCTGTCTGTATTCACAGTGCCTCAGTAGAACAGAGGAGCGGGTTAAGTCGTTACCGTGGCCTTTAGGTTGCAACTCAA
CTCCTGCCCTCCTAATCATTTGAACATCTTTAGCAGGACCAAGCCCTTCTGTTGTCTACGTAGGTTTGGTGACTGACGAATCAGATTTTCTTACATTGCA
CTGTAAACATCAGAATTAAATAACAGGTCGTATCTGATATATGGCAGATATTCAGCTATTTCAATGTGTCCTGTTAACTGAATCAAACATTCATAAATCT
GATCGGACTGAGGATGTGTCTTGTCTGTAACAAAAAACTCAAAAATATTTCCATTTACTTCAACAGAGCTGCAACCAGGTGTTTTTTGTAATCCTCTTTC
ACCCATCATCTTCCTCACATCTCGTGCCTTATGTTGCATATTTGCTTCAACATACATGTTAGCAAGTAAGACATAAGTTCCACTATCACCAGGATCCAAT
TCAAGAAGTTTCAGAGCTGCCTTTTCCCCCATCTCAATGTTCCTGTGAACTCGACAAGCGAAAAACAATGCTCCCCATACCGAAGCATCAGCCTCATTTG
GCACTCCACGGACAAGCTCATAAGCTTCTTCCAGAAGCCCTGCCCTGCCCAAAAGGTCCACCATGCAAGCGTAATGTTTAGATTTAGGCAGAATGTTGAA
CTTTGTGGTCATTTGAGTAAAAAATTTCTCCCCTCTTTAACCAAACCTCCATGACAACAAGCTGACAAGACCCCAATAAATGTGACATCATCTGGTCCTC
AAACACTGGTCACCATCTTTAAAAAA
>LE_HBa0095I03_T7_28421 (trimmed for quality and cloning vector)
AGCTTGAGCACTGTATTCACAGTTAGTAGTGATGCCTCCAGTTAAAACAAAAGAACATTTAGATCCATCCTTGAGCTGTCTGTATTCACAGTGCCTCAGT
AGAACAGAGGAGCGGGTTAAGTCGTTACCGTGGCCTTTAGGTTGCAACTCAACTCCTGCCCTCCTAATCATTTGAACATCTTTAGCAGGACCAAGCCCTT
CTGTTGTCTACGTAGGTTTGGTGACTGACGAATCAGATTTTCTTACATTGCACTGTAAACATCAGAATTAAATAACAGGTCGTATCTGATATATGGCAGA
TATTCAGCTATTTCAATGTGTCCTGTTAACTGAATCAAACATTCATAAATCTGATCGGACTGAGGATGTGTCTTGTCTGTAACAAAAAACTCAAAAATAT
TTCCATTTACTTCAACAGAGCTGCAACCAGGTGTTTTTTGTAATCCTCTTTCACCCATCATCTTCCTCACATCTCGTGCCTTATGTTGCATATTTGCTTC
AACATACATGTTAGCAAGTAAGACATAAGTTCCACTATCACCAGGATCCAATTCAAGAAGTTTCAGAGCTGCCTTTTCCCCCATCTCAATGTTCCTGTGA
ACTCGACAAGCGAAAAACAATGCTCCCCATACCGAAGCATCAGCCTCATTTGGCACTCCACGGACAAGCTCATAAGCTTCTTCCAGAAGCCCTGCCCTGC
CCAAAAGGTCCACCATGCAAGCGTAATGTTTAGATTTAGGCAGAATGTTGAACTTTGTGGTCATTTGAGTAAAAAATTTCTCCCCTCTTTAACCAAACCT
CCATGACAACAAGCTGACAAGACCCCAATAAATGTGACATCATCTGGTCCTCAAACACTGGTCACCATCTTTAAAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.973144
Expected error %
1.27985
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g22410.1 Score 199 E Value 2e-51 Identity 18.70% Align. Length 518bp (59.00%) Frame 1
68415.m02657 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g21300.1 Score 156 E Value 1e-42 Identity 45.70% Align. Length 553bp (62.98%) Frame 1
68417.m03077 pentatricopeptide (PPR) repeat-containing protein contains INTERPRO:IPR002885 PPR repeats
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD22358.1| Score 199 E Value 8e-50 Identity 18.70% Align. Length 518bp (59.00%) Frame 1
hypothetical protein [Arabidopsis thaliana] gb|AAL57637.1| At2g22410/F14M13.19 [Arabidopsis thaliana] ref|NP_179827.1| pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] pir||C84612 hypothetical protein At2g22410 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP53645.1| Score 194 E Value 4e-57 Identity 58.20% Align. Length 535bp (60.93%) Frame 1
putative selenium-binding protein-like [Oryza sativa (japonica cultivar-group)] ref|NP_921358.1| putative selenium-binding protein-like [Oryza sativa (japonica cultivar-group)] gb|AAK50416.1| Putative selenium-binding protein-like [Oryza sativa]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0095I03
Clone
Clone name
hba-95i3
LE_HBa0095I03
P095I03
Clone type
BAC
Contamination
none
Estimated length
101,046
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found