Clone Read LE_HBa0006L06_T7_2843

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006L06_T7_2843
Primer
T7
ID from Seq. Facility
LE_HBa_006_L06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
832 trimmed for vector and quality, 990 raw
Genbank Accession
Sequence
>LE_HBa0006L06_T7_2843 (raw untrimmed)
GGCCTTACTTGTACCCGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAACCATCCATGCTCCACCCAAGTAAAGACCTAAAAGTGGGCCAGCT
AGAAGCATTTGAGTAAGGGGATCAGTTGATGGTGTGAGCACTGCAGCAGCAACGACAGCACCTACCACCACGTATCTCCAAATCGACAGCATTTGATCTC
CTGACACAAGACCAGTTTGTCCCAGAAGCAGTTGAATGACAGGAACCTGTAAAAGAGAGTAATTATAGAGTTGCTTATTGGATTAAAGCAATTTGGATAT
AAAGAGGATGCCGATCAACATCATACAATAGTGTGAATTCACAAATATTTTCACTACGATGAAGACCATGCTAGAATCTTGAAAGCTTCACCACTGAAAA
TCATCATTCTCACTTGTTTAAGCGTACCTCTATTCCACCAGGTACATATTACCTCCGACCAACACATGTACTAGGTAACTCTGTCCATCAAAGCTTAGGT
AGATGAGAAGAAATTGCCTAACATTTTTTCTTTCTACCGGATTGGAATTTTGATTTATGAATTCCAGTCACTTCATTTGCCCGCTAGGCCACACCCTTGG
GTGCTTAATATTTCTTATACTCGCTTCTATTTTTATCGCAAAACATTGCTCAATTATGGCCAAGATGCTTTTAAGCAAGCATTAGTTACAAGTCGAGCCA
ACCTAGAACACAAAAGTGAAGTATGGCCAAAGATTTGAGAAGCTCTAGATTGAAAAACAAAATTTCCTACCACTAAACTGTTTATCATGCAGCATGTTCT
TATATACTCAAGCAGAAAAGAAAACAGCACAAGCCAAACTGGAAAGACAACCCTGTACTGAACATGAGTACGAGCACAAATTCGAAGTATTGATTCATGG
ACCCAAAAGATTCACCGCCCCCTCTGCATAATTAACAAGAAATTAAGGCTGCTGGAGTGAGGACAAGTGTGAAAAACAAGCCGGCTAAAA
>LE_HBa0006L06_T7_2843 (trimmed for quality and cloning vector)
AGCTTAACCATCCATGCTCCACCCAAGTAAAGACCTAAAAGTGGGCCAGCTAGAAGCATTTGAGTAAGGGGATCAGTTGATGGTGTGAGCACTGCAGCAG
CAACGACAGCACCTACCACCACGTATCTCCAAATCGACAGCATTTGATCTCCTGACACAAGACCAGTTTGTCCCAGAAGCAGTTGAATGACAGGAACCTG
TAAAAGAGAGTAATTATAGAGTTGCTTATTGGATTAAAGCAATTTGGATATAAAGAGGATGCCGATCAACATCATACAATAGTGTGAATTCACAAATATT
TTCACTACGATGAAGACCATGCTAGAATCTTGAAAGCTTCACCACTGAAAATCATCATTCTCACTTGTTTAAGCGTACCTCTATTCCACCAGGTACATAT
TACCTCCGACCAACACATGTACTAGGTAACTCTGTCCATCAAAGCTTAGGTAGATGAGAAGAAATTGCCTAACATTTTTTCTTTCTACCGGATTGGAATT
TTGATTTATGAATTCCAGTCACTTCATTTGCCCGCTAGGCCACACCCTTGGGTGCTTAATATTTCTTATACTCGCTTCTATTTTTATCGCAAAACATTGC
TCAATTATGGCCAAGATGCTTTTAAGCAAGCATTAGTTACAAGTCGAGCCAACCTAGAACACAAAAGTGAAGTATGGCCAAAGATTTGAGAAGCTCTAGA
TTGAAAAACAAAATTTCCTACCACTAAACTGTTTATCATGCAGCATGTTCTTATATACTCAAGCAGAAAAGAAAACAGCACAAGCCAAACTGGAAAGACA
ACCCTGTACTGAACATGAGTACGAGCACAAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.970854
Expected error %
0.337219
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g01110.1 Score 76 E Value 3e-14 Identity 20.20% Align. Length 197bp (23.68%) Frame 1
68415.m00019 thylakoid membrane formation protein / cpTatC (APG2) identical to thylakoid membrane formation protein (cpTatC) GI:15004994 from [Arabidopsis thaliana]; contains Pfam profile PF00902: MttB family; identical to cDNA apg2 for cpTatC GI:15004993
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_918586.1| Score 77 E Value 7e-13 Identity 21.20% Align. Length 197bp (23.68%) Frame 1
OsTATC [Oryza sativa (japonica cultivar-group)] dbj|BAB64068.1| putative TatC [Oryza sativa (japonica cultivar-group)] dbj|BAB39766.1| OsTATC [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL07196.1| Score 76 E Value 1e-12 Identity 20.20% Align. Length 197bp (23.68%) Frame 1
putative TATC protein [Arabidopsis thaliana] gb|AAK25882.1| putative TATC protein [Arabidopsis thaliana] gb|AAM61351.1| TATC-like protein [Arabidopsis thaliana] dbj|BAB62074.1| cpTatC [Arabidopsis thaliana] gb|AAF18659.2| TATC-like protein [Arabidopsis thaliana] ref|NP_565252.1| thylakoid membrane formation protein / cpTatC (APG2) [Arabidopsis thaliana] gb|AAD33946.1| TATC [Arabidopsis thaliana] pir||T44583 conserved hypothetical protein tatC [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006L06
Clone
Clone name
hba-6l6
LE_HBa0006L06
P006L06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found