Clone Read LE_HBa0006L20_T7_2871

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006L20_T7_2871
Primer
T7
ID from Seq. Facility
LE_HBa_006_L20-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
913 trimmed for vector and quality, 969 raw
Genbank Accession
Sequence
>LE_HBa0006L20_T7_2871 (raw untrimmed)
GGGCTTACTGGTACCGAGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACCACATCCCTGCAGTTTTACCTTTTCAAGATTGGGGAAGGATTCC
TCTCCAACCTCCCACTTCGAAAGAGTCGGTAGACACAAGTTCAAAAATTTGAGATTCATAAAGGTGTCTTCCTCCCCCATGTTCCATTCTTCTCCCTGGA
TGATTGCATCATAAAGGGACAACTCTTCTAGGTTGTGCAGTCTCGCTATTGTTGATAGCGAATCGGATGTCAGAGGAAAGTCAGACAACAACAGTTGTTT
CAAATTTGAAGGGAAGTGAAAATCCCACGGCCGATTTGTCGCTACAGAGGACCCAATGTGGTTTGTGTTTGAACTTTCAAAACTTACACTGAGTTGTTCT
AGTTCAGTTAGGCAATCCAATTTCGGGAACCAATATTGCTCTGTTGAATAATCCCATGACTCCTTGAGTTCAAACTGAAGCACCTGAAGATTGGGAAACC
TTTTGAAAATATTCTTTGTATCTTTCAAATAGGAAATCACCAGTTCCCCTAATATTCTCAAGTTCTCTAACTTTGTGTCCTCTGCAATCAATATTGATTC
ATCTGCATCCATATCAAAGAAAGAACAAGCACTCACGAACAGCGCTCGCAGCTTTACAAGATCCCAAATTCTTGGTAATAGTATCAAGGTTGATTCTTTG
TTATTCACCGACAAGATTTCTAGATTCCAGAGGTTTGAGAAAGACAAAGGCAGATATTTAACTTCTGTCCCAATTCTTAAGTACCTCAAATGATTCAACA
TGCATATTTCATTCAGCAAAGAATCATTCACCATGATAAAAGAGTTATCCAGGTCCAACACTCTAAGAAGCCTCAAGTGTCTTAGGTGAAATGCATCAGA
AACACTGTCATCCAGTTGGTCTCCATTTTTCCCCAAGAAAGAAGTGTTTACCAAATGCCTTTTCTATTT
>LE_HBa0006L20_T7_2871 (trimmed for quality and cloning vector)
AGCTTACCACATCCCTGCAGTTTTACCTTTTCAAGATTGGGGAAGGATTCCTCTCCAACCTCCCACTTCGAAAGAGTCGGTAGACACAAGTTCAAAAATT
TGAGATTCATAAAGGTGTCTTCCTCCCCCATGTTCCATTCTTCTCCCTGGATGATTGCATCATAAAGGGACAACTCTTCTAGGTTGTGCAGTCTCGCTAT
TGTTGATAGCGAATCGGATGTCAGAGGAAAGTCAGACAACAACAGTTGTTTCAAATTTGAAGGGAAGTGAAAATCCCACGGCCGATTTGTCGCTACAGAG
GACCCAATGTGGTTTGTGTTTGAACTTTCAAAACTTACACTGAGTTGTTCTAGTTCAGTTAGGCAATCCAATTTCGGGAACCAATATTGCTCTGTTGAAT
AATCCCATGACTCCTTGAGTTCAAACTGAAGCACCTGAAGATTGGGAAACCTTTTGAAAATATTCTTTGTATCTTTCAAATAGGAAATCACCAGTTCCCC
TAATATTCTCAAGTTCTCTAACTTTGTGTCCTCTGCAATCAATATTGATTCATCTGCATCCATATCAAAGAAAGAACAAGCACTCACGAACAGCGCTCGC
AGCTTTACAAGATCCCAAATTCTTGGTAATAGTATCAAGGTTGATTCTTTGTTATTCACCGACAAGATTTCTAGATTCCAGAGGTTTGAGAAAGACAAAG
GCAGATATTTAACTTCTGTCCCAATTCTTAAGTACCTCAAATGATTCAACATGCATATTTCATTCAGCAAAGAATCATTCACCATGATAAAAGAGTTATC
CAGGTCCAACACTCTAAGAAGCCTCAAGTGTCTTAGGTGAAATGCATCAGAAACACTGTCATCCAGTTGGTCTCCATTTTTCCCCAAGAAAGAAGTGTTT
ACCAAATGCCTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.964808
Expected error %
1.0767
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC32252.1| Score 478 E Value 1e-133 Identity 27.70% Align. Length 875bp (95.84%) Frame 1
disease resistance gene homolog Mi-copy2 [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC97933.1| Score 478 E Value 1e-133 Identity 27.70% Align. Length 875bp (95.84%) Frame 1
disease resistance protein [Lycopersicon esculentum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006L20
Clone
Clone name
hba-6l20
LE_HBa0006L20
P006L20
Clone type
BAC
Contamination
none
Estimated length
117,083
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found