Clone Read LE_HBa0095P04_T7_28759

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0095P04_T7_28759
Primer
T7
ID from Seq. Facility
LE_HBa_095_P04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
761 trimmed for vector and quality, 874 raw
Sequence
>LE_HBa0095P04_T7_28759 (raw untrimmed)
CCCCTATCCTCTTCTATGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAAAAATTGTGTGAGTATACATGACTGTTTCCGGTCCTCATAATGT
TTTTTAAGAAAAAATTTGGGTGTTTTGTGCGCCAGATCCGTGGGCTAATACACACGAAAAATTGAGATATTTGCATGATTCCAATAGGGCATCTAGATAC
GGAAATGTGTGTGAATGAAATAGTGTGAGTATACGTGATGGTTCCCAGACTCAATACTAAGTTCTTCATAATGCTTTTGATAAAAAGAATTTGGGTGTTT
TGGGCTCCAGAGACACACGGGCGAATACACCCGAAAATTGAGCAATTTGTGATATTCTAAAAGTGGGCCTGTAGATGATGAAATTGACGTGAAAAATGGT
TTGAGTATAAGTTATAGTTCCCCAACTCAATACGGAGGTCCGTATAATTTTTTTTGAGAAAGACAATTTGGGTGACTTAGGTGCCAGATCAATGAGATTA
TACATTGGAAAATTTAGGAATATTTGTGATTTCTAAAAAGGACTTATAAATTCAAAAATGGGCGTGAAATAATAGGTGTGATTATATGTTATAGCCCCCA
ATTCAATACGAAGTGCTCATAATATTTTTGAGAAAAAAATTTAGGGTGCTCTTGTGCCAAATCCATGGTCTTATACCGCATGAAAAGTTTGAGGAAATTT
GACCAAAGATTAGTAAATAAAAAAATGTGCTTGAAAAATAATGTGAAGTAAACATGATGGTTACCAAACTTTATAAGGAGGTCCTCCCGAAATTTTTGAG
AAAATTGGTTGTTGGCTCACGGCCCTTGATCGTTTGGCACTATACATGGAAAAATCAGAAATTTAGGCCCTTCC
>LE_HBa0095P04_T7_28759 (trimmed for quality and cloning vector)
AGCTTCAAAAATTGTGTGAGTATACATGACTGTTTCCGGTCCTCATAATGTTTTTTAAGAAAAAATTTGGGTGTTTTGTGCGCCAGATCCGTGGGCTAAT
ACACACGAAAAATTGAGATATTTGCATGATTCCAATAGGGCATCTAGATACGGAAATGTGTGTGAATGAAATAGTGTGAGTATACGTGATGGTTCCCAGA
CTCAATACTAAGTTCTTCATAATGCTTTTGATAAAAAGAATTTGGGTGTTTTGGGCTCCAGAGACACACGGGCGAATACACCCGAAAATTGAGCAATTTG
TGATATTCTAAAAGTGGGCCTGTAGATGATGAAATTGACGTGAAAAATGGTTTGAGTATAAGTTATAGTTCCCCAACTCAATACGGAGGTCCGTATAATT
TTTTTTGAGAAAGACAATTTGGGTGACTTAGGTGCCAGATCAATGAGATTATACATTGGAAAATTTAGGAATATTTGTGATTTCTAAAAAGGACTTATAA
ATTCAAAAATGGGCGTGAAATAATAGGTGTGATTATATGTTATAGCCCCCAATTCAATACGAAGTGCTCATAATATTTTTGAGAAAAAAATTTAGGGTGC
TCTTGTGCCAAATCCATGGTCTTATACCGCATGAAAAGTTTGAGGAAATTTGACCAAAGATTAGTAAATAAAAAAATGTGCTTGAAAAATAATGTGAAGT
AAACATGATGGTTACCAAACTTTATAAGGAGGTCCTCCCGAAATTTTTGAGAAAATTGGTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.941407
Expected error %
1.23808
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0095P04
Clone
Clone name
hba-95p4
LE_HBa0095P04
P095P04
Clone type
BAC
Contamination
none
Estimated length
100,167
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found