Clone Read LE_HBa0006M01_SP6_2880

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006M01_SP6_2880
Primer
SP6
ID from Seq. Facility
LE_HBa_006_M01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
603 trimmed for vector and quality, 945 raw
Genbank Accession
Sequence
>LE_HBa0006M01_SP6_2880 (raw untrimmed)
CCCCTCCTTTCTAGTGCTACTCAGGACTCCCCGAGAGCCAACCCGCAGGTCCGGCACCATGTTTCTGCAAATAAGTGATGACATTTTAACACTTCATTAC
GAG
GAAGCACTTGAAAGATTAAATATTGAGATCCCCTTCCTTTTCCGGAAGAGGTTTTGGGAGAAGGTGGTTAACCTAAGATGGAAATAACTGCAGCTCG
AGCTGCCAGCTGTTCAGCTTCTTTCTTGTTTTTCCCGATTTCTCCCGTATAATGAATACCATTGAAGAACGAGGTAGACTTAAAAACAGGAAGCACTGCC
ACAGATTGACTTGTCTGATAAGTAGGTTTCTCCAGGTTCATTTTAACAGCATACTCATTTAGGATAGACTTGCAAAACACTGTATCCTAGAGTACATAAA
GGTAAAATAGTATTAGAAATATGAAAAAGGATATATAATGCAGACTGTCAGAGAACACCTTCCAGTTCCAGCTTTGGTGTAAATGGATATAGAGAACTTT
TATAGGGTTGATTTGACCAATAGTTGAAACAGATTGGGATCAATTGATCTTTGGAGCATAAGTTTAAAATTTCAGAAACTATAGAAACAAAGAACCTTGT
CTGCTAGACCTAAGATCGGACACCTCACTAGTACTGAAGCCCTCCGATTAGCCTCATTCTCTGGCTCTTTAACACATGATAAATAAATCAACCTACTTTT
TTGAAACAGAATGTGCCCATCCTATATCCAAACGCCATACTAGTACAACAGCTCTAACTGATAGCTTTTCCATTAATTCCATTCTCCGGCTCTTCAACCT
TCTCCCTTAATTAATGATCTTTTTTACTTCAACGTACCCCTTACATTCATTTTGGCAAAATGAAAATGAACTAAATGTTCATCGTCCCGTGGTTAGAGAT
AAAAGTTTTTCCCCCCCGTCCTCCTCTCCCTCTCCCCTCTCTGAT
>LE_HBa0006M01_SP6_2880 (trimmed for quality and cloning vector)
GAAGCACTTGAAAGATTAAATATTGAGATCCCCTTCCTTTTCCGGAAGAGGTTTTGGGAGAAGGTGGTTAACCTAAGATGGAAATAACTGCAGCTCGAGC
TGCCAGCTGTTCAGCTTCTTTCTTGTTTTTCCCGATTTCTCCCGTATAATGAATACCATTGAAGAACGAGGTAGACTTAAAAACAGGAAGCACTGCCACA
GATTGACTTGTCTGATAAGTAGGTTTCTCCAGGTTCATTTTAACAGCATACTCATTTAGGATAGACTTGCAAAACACTGTATCCTAGAGTACATAAAGGT
AAAATAGTATTAGAAATATGAAAAAGGATATATAATGCAGACTGTCAGAGAACACCTTCCAGTTCCAGCTTTGGTGTAAATGGATATAGAGAACTTTTAT
AGGGTTGATTTGACCAATAGTTGAAACAGATTGGGATCAATTGATCTTTGGAGCATAAGTTTAAAATTTCAGAAACTATAGAAACAAAGAACCTTGTCTG
CTAGACCTAAGATCGGACACCTCACTAGTACTGAAGCCCTCCGATTAGCCTCATTCTCTGGCTCTTTAACACATGATAAATAAATCAACCTACTTTTTTG
AAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956879
Expected error %
0.749748
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006M01
Clone
Clone name
hba-6m1
LE_HBa0006M01
P006M01
Clone type
BAC
Contamination
none
Estimated length
116,693
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found