Clone Read LE_HBa0096C10_SP6_28914

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0096C10_SP6_28914
Primer
SP6
ID from Seq. Facility
LE_HBa_096_C10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
381 trimmed for vector and quality, 782 raw
Sequence
>LE_HBa0096C10_SP6_28914 (raw untrimmed)
TCCTTCTCTCCAACCTCTCTTGAGGGAGACTGCTTAAGTTGTCGGCGGTGCGACTAACTTGCCCTCAATATACTGAATACTTACTCGCCAGGAAATTTGC
AGCCAAGAATATTATGGCGGAAGATAATTGAAAGCCAAAAAAAAAATCCCCCCAAAACAGTGAATAGAAGGCCCTATATATACTAAATTTTGACGGACGG
AGAGCGGAGGATATCACAAAAAGGGTTGGGGTAAAATCGCGATTTCATTTCCCAATTTGAAATCCAAAAAAAACTAAAAGGATATGGTTGAAATGGAATG
GTACGAATTTGTATTATTCTCCAACACCAAGATGACCATAGTCGTCCGATTTGAAGGAGAGGACGAGAGGGGAGAGGAGATTTCGACACCTAGGTATACC
ATTCGTATGAAAGAAAGGGAGAGGGGAAGGGGACTCGCTGTACAGGAGATGGGAGGAATTGCGTGGCTGTTGATCGTAGGAATGTGTTAAGAAGAACAAT
GAGTAACGTGTCAGGTTAACACTGTTACGGTAGAATAGGAAATGAGGGTACGCTCTGAAAAAATGGACAGACAAGGCGTCTGTGTACTTATATTAAAGTT
CATATGTAGTGTTGCATATTAAACTTATCTCTTACATCAGACTCATAGACGCCATACTCTTTACAAAGCCTTCTCACTTGATCTTCACCGTTGCGTCCAT
TCCGCACCACCTTGGTGCGTTCAGTGTCTCTGGTTGACAGTGTCTGTTGTTTTTATGAACTATAATTCCTTCTTCTTATTTT
>LE_HBa0096C10_SP6_28914 (trimmed for quality and cloning vector)
CCTCAATATACTGAATACTTACTCGCCAGGAAATTTGCAGCCAAGAATATTATGGCGGAAGATAATTGAAAGCCAAAAAAAAAATCCCCCCAAAACAGTG
AATAGAAGGCCCTATATATACTAAATTTTGACGGACGGAGAGCGGAGGATATCACAAAAAGGGTTGGGGTAAAATCGCGATTTCATTTCCCAATTTGAAA
TCCAAAAAAAACTAAAAGGATATGGTTGAAATGGAATGGTACGAATTTGTATTATTCTCCAACACCAAGATGACCATAGTCGTCCGATTTGAAGGAGAGG
ACGAGAGGGGAGAGGAGATTTCGACACCTAGGTATACCATTCGTATGAAAGAAAGGGAGAGGGGAAGGGGACTCGCTGTAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945999
Expected error %
1.38838
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0096C10
Clone
Clone name
hba-96c10
LE_HBa0096C10
P096C10
Clone type
BAC
Contamination
none
Estimated length
107,338
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found