Clone Read LE_HBa0096C10_T7_28915

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0096C10_T7_28915
Primer
T7
ID from Seq. Facility
LE_HBa_096_C10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
251 trimmed for vector and quality, 812 raw
Sequence
>LE_HBa0096C10_T7_28915 (raw untrimmed)
AGCGGGTTTAATCCGATAAGGAAGGACTTCAAGGAATCACGAAAGTACGCAGCAATTTGACCTCTATATAGAGTCTTAACCATACGGTGTGAGTCGCGAC
ACATCAATAGGGCGAGAGGCTATAGGATGATAGACTTTCCCTTCTTTTCTACTCCTATGTCGTGTCGTAGAGTAAAAGTTATGAGTACTCCTTTTTTATG
GTTTTCCTTGTGTTTCTAGGAAGATAAATACGAGGAGGACACCGGCTAGGATAGTTGAGGAGAATGATGTGAATGAGGAGATTCTTCCTCATGTTGACGA
AGTTAAGCAAGTTGCCCTTCGTGACCAAGTCCTTATTGGAGGTCAAGGTAATGAGGTTCCGGTGGTTCCCCATGAAATGGTCTCTTGGGAGATTAGAGAG
ACTTTACTTACTTTAGCCTGAGCTGTGACTACCCATGAGAATATATGTTTGGTATCTAGAGTGTGTGTTTTGTTTTTATTTTTCTTCTCTCTGTTTTGTT
ACTTTGTCAGACTGAGTTCTCCTATCTTTGTTGCAAGTATGGCGACTAATGGTTCCATTATTTAATTTTATCATTAGATATCTATATGTTTGTTGTTGAG
TTTTTGTATTTCTGTTTGTGTTATTTCTATTTGTTTGTTATCTTCTTCTTCTGCGTTCTCTTCGTTCCCTACCTCTCGTGAACACCTATATATTCTTTCG
CCTTCATATGAAACTTACTACTTTTACATAATGTGTATGCCTTTCGCTACTGGCGATCCCATTTAACGCATATAATTTCGTGCATATTAACACCGTGAAT
ATCTTTTGAACG
>LE_HBa0096C10_T7_28915 (trimmed for quality and cloning vector)
GCGACACATCAATAGGGCGAGAGGCTATAGGATGATAGACTTTCCCTTCTTTTCTACTCCTATGTCGTGTCGTAGAGTAAAAGTTATGAGTACTCCTTTT
TTATGGTTTTCCTTGTGTTTCTAGGAAGATAAATACGAGGAGGACACCGGCTAGGATAGTTGAGGAGAATGATGTGAATGAGGAGATTCTTCCTCATGTT
GACGAAGTTAAGCAAGTTGCCCTTCGTGACCAAGTCCTTATTGGAGGTCAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959657
Expected error %
0.812941
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0096C10
Clone
Clone name
hba-96c10
LE_HBa0096C10
P096C10
Clone type
BAC
Contamination
none
Estimated length
107,338
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found