Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Clone Read LE_HBa0096I05_SP6_29192

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0096I05_SP6_29192
Primer
SP6
ID from Seq. Facility
LE_HBa_096_I05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
705 trimmed for vector and quality, 903 raw
Sequence
>LE_HBa0096I05_SP6_29192 (raw untrimmed)
CGCCAAGTTTGGTTGGGATTGGGATATCCATGGGTTGTTTCTTTGTAGAATAAATTCAAACACAAAAAACTGTACAAGCCATCATATAAGTAGTAATTTT
GATTTGCCTCTTTTTTTTAAAAGAAATTGATTTTTTTAAAAAAAAAATAATAATCAGATCCTCTTGACTTTTTTTTGTTCTTCGTAAATGTGATTTTATT
GTGGATAACACAGTGTGAACACATTAAAACGTATGTAACGGTTCTATGAACCATTAGACTCTCCTGTTTTCTTATTATTTATCCCCTTAACTAATTACAT
GGTAAAAAAATTTAGTGTCACTAAAAAAGTATTAATTACATCATTTAAATGATTAAACAAACTTAGTTACTTTGCCAAGTTTAAGTTTTCCTCAAGCTAG
TCTAGACTTAAAGCCTGTGTTGAAATTACTGCTAAAATCTGCTTATTTTTGGAAACACCTTTTAAATTAGTTTTTTAGAAAAGCGCTTTAAAAAATAATA
ATTTGTGTTTTTAAAAATTGCTTTGAAGTGTTAAATTACAAAACGGACAAGGATCAATCTACTTTCACTATAAAGATTATTTTATATATTAAAATTATTT
TAAATATCTATCTATCATAAGAAATTTAATTTTATTGAATCAAAATGTACTTATTCAATTTTTCAATCAATACTATACATATATAAATAAATAAAATTAT
AATATTGATAGGATATTTAAATATAATAAATAGTATTAAATATGAAATAATGATAATAAATGTAAAAGAATAAAATGAATATTATATAAAAATAAAATTC
TTAAATGAATCTTTTACCAAATTTATGAGATATATTAATTTATTTAATAAGAATTTATGGGAAAATATGCAAAAATAAAAAAATTTTTTTTGTTTGAAAA
AAG
>LE_HBa0096I05_SP6_29192 (trimmed for quality and cloning vector)
TTGTTTCTTTGTAGAATAAATTCAAACACAAAAAACTGTACAAGCCATCATATAAGTAGTAATTTTGATTTGCCTCTTTTTTTTAAAAGAAATTGATTTT
TTTAAAAAAAAAATAATAATCAGATCCTCTTGACTTTTTTTTGTTCTTCGTAAATGTGATTTTATTGTGGATAACACAGTGTGAACACATTAAAACGTAT
GTAACGGTTCTATGAACCATTAGACTCTCCTGTTTTCTTATTATTTATCCCCTTAACTAATTACATGGTAAAAAAATTTAGTGTCACTAAAAAAGTATTA
ATTACATCATTTAAATGATTAAACAAACTTAGTTACTTTGCCAAGTTTAAGTTTTCCTCAAGCTAGTCTAGACTTAAAGCCTGTGTTGAAATTACTGCTA
AAATCTGCTTATTTTTGGAAACACCTTTTAAATTAGTTTTTTAGAAAAGCGCTTTAAAAAATAATAATTTGTGTTTTTAAAAATTGCTTTGAAGTGTTAA
ATTACAAAACGGACAAGGATCAATCTACTTTCACTATAAAGATTATTTTATATATTAAAATTATTTTAAATATCTATCTATCATAAGAAATTTAATTTTA
TTGAATCAAAATGTACTTATTCAATTTTTCAATCAATACTATACATATATAAATAAATAAAATTATAATATTGATAGGATATTTAAATATAATAAATAGT
ATTAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.87227
Expected error %
0.062215
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0096I05
Clone
Clone name
hba-96i5
LE_HBa0096I05
P096I05
Clone type
BAC
Contamination
none
Estimated length
131,470
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found