Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Clone Read LE_HBa0096I05_T7_29193

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0096I05_T7_29193
Primer
T7
ID from Seq. Facility
LE_HBa_096_I05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
817 trimmed for vector and quality, 921 raw
Sequence
>LE_HBa0096I05_T7_29193 (raw untrimmed)
TAGCCCGGGACCCGGGGGAATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACTATATATACGATTAATAACTTTATATTATACAATCAATTTAATCAT
TAATATTTTTTTAAATTAAAAACTTGAAATCACAGATGCACATCTATAACAGTAATATATATATCAAAATTATTGTACATTCTACAAATTCCTAAAAGAA
ATTGAGAAAATATTTGACTTTGAACTGGTATTGTCTTTCTATAGCTTTAGAATTCTTTTTTTGGAAAAATATTTGATTTTGAATGTTTTGCTTAAATCAT
GGTTGTTACCATCTTTTGTGCTACTGTTACCATTTATTAAAAAATAATTTTTTGTATAAATTTAATTAAAAAAACTTTTTATACAAATTTGAAGTCACTT
AACAAACTAAACTATATCCATGAAATGTAATTATTTAAACTATACCCACAAAATGTAATTTCATAAAATATGTTTGCCATATATGAAATTTCCCCTTCTA
TAAAACTACTCTTTGGCTGGGATTGCCACCTCTTTCCTTCTTCAATTCTCAAATCGACATTCACACCATCCATGGAAGCTCTCGCACATATATTTTTTTT
ACAAGAAAAAATTATCCTTAAGCTCTGCGAAATGATTCAAATTTGTCTCTTAACTTTTTGAATTTATTTTTTCAGTCATCATCCACCATTGTTCTAAATC
AATTACCACAATAAAAATTTTATTTATTTTTCACTCTCAAAAACACCACTTGAAGATCATTATTACCTATGGTCATATTTTTCTCTTGACACAATCACAT
AACATACACACGGAAATTCACATAATTATTTGTAGAGCTTTCACATCACCGTACTATTGATGAATTAGGAAGGGATTAAAAATGAGTTAGAATGAGGTCC
ACTTGTTCATGATTCAATGAT
>LE_HBa0096I05_T7_29193 (trimmed for quality and cloning vector)
AGCTTACTATATATACGATTAATAACTTTATATTATACAATCAATTTAATCATTAATATTTTTTTAAATTAAAAACTTGAAATCACAGATGCACATCTAT
AACAGTAATATATATATCAAAATTATTGTACATTCTACAAATTCCTAAAAGAAATTGAGAAAATATTTGACTTTGAACTGGTATTGTCTTTCTATAGCTT
TAGAATTCTTTTTTTGGAAAAATATTTGATTTTGAATGTTTTGCTTAAATCATGGTTGTTACCATCTTTTGTGCTACTGTTACCATTTATTAAAAAATAA
TTTTTTGTATAAATTTAATTAAAAAAACTTTTTATACAAATTTGAAGTCACTTAACAAACTAAACTATATCCATGAAATGTAATTATTTAAACTATACCC
ACAAAATGTAATTTCATAAAATATGTTTGCCATATATGAAATTTCCCCTTCTATAAAACTACTCTTTGGCTGGGATTGCCACCTCTTTCCTTCTTCAATT
CTCAAATCGACATTCACACCATCCATGGAAGCTCTCGCACATATATTTTTTTTACAAGAAAAAATTATCCTTAAGCTCTGCGAAATGATTCAAATTTGTC
TCTTAACTTTTTGAATTTATTTTTTCAGTCATCATCCACCATTGTTCTAAATCAATTACCACAATAAAAATTTTATTTATTTTTCACTCTCAAAAACACC
ACTTGAAGATCATTATTACCTATGGTCATATTTTTCTCTTGACACAATCACATAACATACACACGGAAATTCACATAATTATTTGTAGAGCTTTCACATC
ACCGTACTATTGATGAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.888675
Expected error %
0.624006
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0096I05
Clone
Clone name
hba-96i5
LE_HBa0096I05
P096I05
Clone type
BAC
Contamination
none
Estimated length
131,470
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found