Clone Read LE_HBa0006M21_T7_2921

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006M21_T7_2921
Primer
T7
ID from Seq. Facility
LE_HBa_006_M21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
843 trimmed for vector and quality, 934 raw
Genbank Accession
Sequence
>LE_HBa0006M21_T7_2921 (raw untrimmed)
GCCCTTACTCGGTACCGAGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCTTGAAGGCGGATGACTCTCCCATGAAAGTCTTTTCTGTTTACC
AGCTAAGCAATGAACACACTTTTTCGGCTTTGCTTGTTTCACTCTAGAAAGCAAATTTTTCTTAGCCAAACTATCAATCCCCTTCTCGCTCATATGACTC
AGCCTTCTATGCCATAACTCTGATGAAGTATCATTCTCCACCAAATTTACTGAGTCTCTGGAGATGGAGCCCTGAAATACATACAAGTTAGACAACTTGT
CACCACGGGCCACAACCATCAAACCTCTAGTAAGCTTCCACTGGCCAACACCAAATGTATTAACATAACCCTCATCATCAAGATATCCCACATAAATCAA
ATTCAAGCGAACATCTGGAGCATGCTTGACATTATTAAGAACTAGTTTGGAACCGTTACTTTCCAAACAAACTGTCCCAATGCCAATAACTTCAACTTCA
TGATTATTGCCCATTTTCAACGTTCCAAAATTACCTGGAGTATAAGAAGAAAATAATTCCTTCTTTGGCGTGACATGAGAAGTAGCACCAGAATCCACAA
ACCAGCTAAGACTCATCACGAACAAGATTAATGGCATTTTCATCACAAGAAACAAGAAGATCATTATTAGCAACAACAGCAACACGATTTTCAGTATCGC
CTTCTCTCTTTTGTTGTCTCATATCTCTCTTGTGCTTGTAACAATATTTCATGATATGCTCATTCTTGTGGCAATAGTCACATGTAATATTCTTGTATTT
AGACTTTGACTTGCTTCTACTTTTTACTCTATCATTCTGACCTCTGAAACTGTTTCCCCCTATCTTCAGTACCAAAACATCGGAGTGTGAAGCTGAAGAA
GATGAGGGCTGAGATCTTCTTCTCATTCTTCATC
>LE_HBa0006M21_T7_2921 (trimmed for quality and cloning vector)
AGCTTTCTTGAAGGCGGATGACTCTCCCATGAAAGTCTTTTCTGTTTACCAGCTAAGCAATGAACACACTTTTTCGGCTTTGCTTGTTTCACTCTAGAAA
GCAAATTTTTCTTAGCCAAACTATCAATCCCCTTCTCGCTCATATGACTCAGCCTTCTATGCCATAACTCTGATGAAGTATCATTCTCCACCAAATTTAC
TGAGTCTCTGGAGATGGAGCCCTGAAATACATACAAGTTAGACAACTTGTCACCACGGGCCACAACCATCAAACCTCTAGTAAGCTTCCACTGGCCAACA
CCAAATGTATTAACATAACCCTCATCATCAAGATATCCCACATAAATCAAATTCAAGCGAACATCTGGAGCATGCTTGACATTATTAAGAACTAGTTTGG
AACCGTTACTTTCCAAACAAACTGTCCCAATGCCAATAACTTCAACTTCATGATTATTGCCCATTTTCAACGTTCCAAAATTACCTGGAGTATAAGAAGA
AAATAATTCCTTCTTTGGCGTGACATGAGAAGTAGCACCAGAATCCACAAACCAGCTAAGACTCATCACGAACAAGATTAATGGCATTTTCATCACAAGA
AACAAGAAGATCATTATTAGCAACAACAGCAACACGATTTTCAGTATCGCCTTCTCTCTTTTGTTGTCTCATATCTCTCTTGTGCTTGTAACAATATTTC
ATGATATGCTCATTCTTGTGGCAATAGTCACATGTAATATTCTTGTATTTAGACTTTGACTTGCTTCTACTTTTTACTCTATCATTCTGACCTCTGAAAC
TGTTTCCCCCTATCTTCAGTACCAAAACATCGGAGTGTGAAGC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963853
Expected error %
0.523773
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV88069.1| Score 258 E Value 5e-83 Identity 67.60% Align. Length 837bp (99.29%) Frame 1
hypothetical retrotransposon [Ipomoea batatas]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T02206 Score 224 E Value 7e-62 Identity 57.60% Align. Length 840bp (99.64%) Frame 1
hypothetical protein - common tobacco retrotransposon Tto1 dbj|BAA11674.1| ORF(AA 1-1338) [Nicotiana tabacum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006M21
Clone
Clone name
hba-6m21
LE_HBa0006M21
P006M21
Clone type
BAC
Contamination
none
Estimated length
113,064
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found