Clone Read LE_HBa0097D15_T7_29741

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0097D15_T7_29741
Primer
T7
ID from Seq. Facility
LE_HBa_097_D15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
736 trimmed for vector and quality, 830 raw
Genbank Accession
Sequence
>LE_HBa0097D15_T7_29741 (raw untrimmed)
ACCTGGTACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTGGTTCGAGTATCGCTTTAAGAATATATGAGGGTTGTTTATTCTCTATAA
TGTATTTATCTCCCAAACTTGTTATCTTGTTTAGATATCATGTTTGTCAGGCGTCTTGCATGAAAGTTTCGTTTTGTATGCCGTATGGGTGGTGTGGATT
TTGGAAATCTGTGGTTTGAAAGGCCATCTTTATCTTGGTGGCCACTTGTGTTAGCTGTCCGAGGTCACAGCCATGTAGTAGGTCGATTGAATGGTCCTTT
CGCTTAGTGTGTTAGATGTTTGGGTGATAAGGTGATCGGGATCCTGTTTTATTTGATGAGGCTGTCCTCTTATGATTGGTTCAAGTTTGTTTCAAATGTT
TGAAGCGCAAAACGGCTAATTGATACTCAATTTATGATGCATCTCTATTTGTATTCGTTATTTATCCCATGCTAAGTCCTTTCTTTAAATATAAAATTTG
GAAATTACCAACAATTTTGTGTGAAGGTTTCACTACACTTGGGGTTTCGCCGCACAGTTTATGTATCGTTATGTAGTGTCATTTAGGTTGACTGATTTGC
ATATCTCTAAGTACCATTAATGTTGTTGGATGTTGGCTTTGCTTCTCATGAAGATTTAATTAGTATTGCATTATAAAGATATCCTTGTTATGCTTTAGAA
CCTTGCTTATTCTAATTGTAGTTTTAAAAAATGCCAATCTTCATTTTTATCTTTTTTTTTTGGGACATGTGAAAACTCCCCGAGAATTCATTATTGGGAA
TCCTATTATCCCTCCCCCCATTTCCAGAGA
>LE_HBa0097D15_T7_29741 (trimmed for quality and cloning vector)
AGCTTTTGGTTCGAGTATCGCTTTAAGAATATATGAGGGTTGTTTATTCTCTATAATGTATTTATCTCCCAAACTTGTTATCTTGTTTAGATATCATGTT
TGTCAGGCGTCTTGCATGAAAGTTTCGTTTTGTATGCCGTATGGGTGGTGTGGATTTTGGAAATCTGTGGTTTGAAAGGCCATCTTTATCTTGGTGGCCA
CTTGTGTTAGCTGTCCGAGGTCACAGCCATGTAGTAGGTCGATTGAATGGTCCTTTCGCTTAGTGTGTTAGATGTTTGGGTGATAAGGTGATCGGGATCC
TGTTTTATTTGATGAGGCTGTCCTCTTATGATTGGTTCAAGTTTGTTTCAAATGTTTGAAGCGCAAAACGGCTAATTGATACTCAATTTATGATGCATCT
CTATTTGTATTCGTTATTTATCCCATGCTAAGTCCTTTCTTTAAATATAAAATTTGGAAATTACCAACAATTTTGTGTGAAGGTTTCACTACACTTGGGG
TTTCGCCGCACAGTTTATGTATCGTTATGTAGTGTCATTTAGGTTGACTGATTTGCATATCTCTAAGTACCATTAATGTTGTTGGATGTTGGCTTTGCTT
CTCATGAAGATTTAATTAGTATTGCATTATAAAGATATCCTTGTTATGCTTTAGAACCTTGCTTATTCTAATTGTAGTTTTAAAAAATGCCAATCTTCAT
TTTTATCTTTTTTTTTTGGGACATGTGAAAACTCCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.937973
Expected error %
0.478568
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0097D15
Clone
Clone name
hba-97d15
LE_HBa0097D15
C08HBa0097D15
P097D15
Clone type
BAC
Contamination
none
Estimated length
59,401
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found