Clone Read LE_HBa0116A07_SP6_299939

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0116A07_SP6_299939
Primer
SP6
ID from Seq. Facility
LE_HBa_116_A07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
421 trimmed for vector and quality, 853 raw
Sequence
>LE_HBa0116A07_SP6_299939 (raw untrimmed)
TCTTAAGCTTTTCACTATGAAAAGCAATAACAATTTCTGATATAGACTCCCGGTATTCTTACTTTCAGTTTCAATTAATTCAGATTCGTGCTATATAGAA
TCCCTTCAAGTAGCCCCTATTAGAAATTTTTGCATTTGAATAGGGCTCAAGTTGGAAGTCTTTAATAAAAATGAAAGTATACAATAAAGACCTATAATAA
GTATGAGTTCACGTGAACTTAGTAATTTTTTTATATATAAATTAAGAAATGCACTAAACATTTAACTTGATATCTTGGTAAGAATTCCTAAATGGAATCC
GTCTTTATGTTCATCTCATATCATATTATTAATAAACGGATTCAAATTTTAAACTTTATAGACCTCTGCAATAACTTTCAAGTTAATATATACAATAATA
ATAATTAAATTCACGGTCAAACATTTAGATTTACATTTAGAGTCTTGAACAAAAGTTAGTCGACAAACCCTTAACCGAATCTCTGATTCCCAAGTATGAT
ACATGCAAGTTTTAATTGCTGTTTGCAGGGAAGAGGTGATTGTGTACAAAGTAATGTAGGTCAGAGTGCCAATAATGTATACAACTTCATCTGCTATCTA
CCATCTCTCTATTACTATGAATGTACTACTTGTTATAAAGCTTTTTGGATCAACAATTTGGTTATCACTTTTCAAAATCTTCTTCGGACTCGACGTAGTC
TTTATACTATTCTTCCTACTCATAATTTCATCCATTTCCACATGTATTTTCAGAAATCCTATACTCATCAACCATTTAATCTATCTTTTGCTTACATTCT
CTCCTCTATAATACTTTCTCTCTTCTTTAAATCCTAATATCTTCTCTTTTCTC
>LE_HBa0116A07_SP6_299939 (trimmed for quality and cloning vector)
ATTTCTGATATAGACTCCCGGTATTCTTACTTTCAGTTTCAATTAATTCAGATTCGTGCTATATAGAATCCCTTCAAGTAGCCCCTATTAGAAATTTTTG
CATTTGAATAGGGCTCAAGTTGGAAGTCTTTAATAAAAATGAAAGTATACAATAAAGACCTATAATAAGTATGAGTTCACGTGAACTTAGTAATTTTTTT
ATATATAAATTAAGAAATGCACTAAACATTTAACTTGATATCTTGGTAAGAATTCCTAAATGGAATCCGTCTTTATGTTCATCTCATATCATATTATTAA
TAAACGGATTCAAATTTTAAACTTTATAGACCTCTGCAATAACTTTCAAGTTAATATATACAATAATAATAATTAAATTCACGGTCAAACATTTAGATTT
ACATTTAGAGTCTTGAACAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.909402
Expected error %
0.668417
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0116A07
Clone
Clone name
hba-116a7
LE_HBa0116A07
C12HBa0116A07
P116A07
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found