Clone Read LE_HBa0116G06_SP6_300211

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0116G06_SP6_300211
Primer
SP6
ID from Seq. Facility
LE_HBa_116_G06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
507 trimmed for vector and quality, 842 raw
Sequence
>LE_HBa0116G06_SP6_300211 (raw untrimmed)
ACAACACATCACAAGGTCACAAGTAAACAGACTAGTTCATGAACAAACACAGCAACAGACAGACACAAAACACCAACAGCAACAGACCCCTTCAAAAACC
ACCACGGAGACGGAGGACAAGGTGCAAAGTAGACTCCTTTTGGATGTTGTAGTCCGCCAGAGTCCTTCCATCTTCAAGTTGCTTCCCTGCAAAGATCAGT
CTCTGCTGGTCCGGTGGGATTCCCTCCTTGTCCTGAATTTTAGCCTTCACATTGTCAATGGTATCAGAACTCTCCACCTCCAAAGTTATGGTTTTCCCAG
TCAAGGTCTTCACAAAAATCTGCATACCTCCCCTGAGCCTCAACACAAGATGAAGGGTTGATTCCTTCTGAATATTGTAATCGGCTAATGTCCTTCCATC
TTCCAACTGCTTGCCAGCAAAAATCAACCTTTGCTGGTCTGGTGGGATACCCTCTTTGTCCTGAATCTTGGCCTTTACGTTGTCAATGGTGTCGGAGCTT
TCCACCTCAAGGGTAATAGTCTTGCCAGTCAAGGTCTTCACGAAAATTTGCTTTCCACCTCGGAAACACAGGACCAAGTGAAGGGTTGATCCCTTTGGGA
TGTTGAAACCACTCAAGGGTACGGTCGGTCCTCAGTTTGCTTTCTGGCAAAAATCAACCTCGCCGGGTTGGGGGAATACCTTCTTTGTCACTGAAATTTG
GCCTAGCCGTTGACATGGCTCATAAACTTTCCCACTCCAGGGTTATTGTCTTGCCATATGAGGTTCTCACAATATTTCCTCCCACCTCCAAAATCAAGGA
CCAATTGAATGGTGACTCACTTCGAAGTTGGTATCATGAAAG
>LE_HBa0116G06_SP6_300211 (trimmed for quality and cloning vector)
ACAACACATCACAAGGTCACAAGTAAACAGACTAGTTCATGAACAAACACAGCAACAGACAGACACAAAACACCAACAGCAACAGACCCCTTCAAAAACC
ACCACGGAGACGGAGGACAAGGTGCAAAGTAGACTCCTTTTGGATGTTGTAGTCCGCCAGAGTCCTTCCATCTTCAAGTTGCTTCCCTGCAAAGATCAGT
CTCTGCTGGTCCGGTGGGATTCCCTCCTTGTCCTGAATTTTAGCCTTCACATTGTCAATGGTATCAGAACTCTCCACCTCCAAAGTTATGGTTTTCCCAG
TCAAGGTCTTCACAAAAATCTGCATACCTCCCCTGAGCCTCAACACAAGATGAAGGGTTGATTCCTTCTGAATATTGTAATCGGCTAATGTCCTTCCATC
TTCCAACTGCTTGCCAGCAAAAATCAACCTTTGCTGGTCTGGTGGGATACCCTCTTTGTCCTGAATCTTGGCCTTTACGTTGTCAATGGTGTCGGAGCTT
TCCACCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959353
Expected error %
0.0782265
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g20620.1 Score 252 E Value 9e-68 Identity 100.00% Align. Length 383bp (75.54%) Frame 3
68418.m02449 polyubiquitin (UBQ4) identical to GI:17677
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g03240.2 Score 252 E Value 9e-68 Identity 100.00% Align. Length 383bp (75.54%) Frame 3
68418.m00273 polyubiquitin (UBQ3) identical to GI:928809
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA54603.1| Score 252 E Value 3e-66 Identity 100.00% Align. Length 383bp (75.54%) Frame 3
pentameric polyubiquitin [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP31578.1| Score 252 E Value 3e-66 Identity 100.00% Align. Length 383bp (75.54%) Frame 3
ubiquitin [Hevea brasiliensis]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0116G06
Clone
Clone name
hba-116g6
LE_HBa0116G06
C10HBa0116G06
P116G06
Clone type
BAC
Contamination
none
Estimated length
136,578
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found