Clone Read LE_HBa0116G09_SP6_300218

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0116G09_SP6_300218
Primer
SP6
ID from Seq. Facility
LE_HBa_116_G09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
545 trimmed for vector and quality, 973 raw
Sequence
>LE_HBa0116G09_SP6_300218 (raw untrimmed)
TCTTGATCAGTCGTGATTCTTTTTAGATATCCGTTGCGTATACATAAAAATGCATCGCCTACTTTATTAATTGGCATTGTTATGTGCTGCTGGCTCCCAA
CTTCTATATGCCTATGCTCACATACTACTTACTATGTATTCTCCTCTGAATAGACAATTGCTTCAACCGAATCCCTGTATTAGACACTATTCTGCGAAAT
GATTTACTGTTCTGCCACTTGATTTGTTATTATCGTTTATCTCCCTTTACAAGTCTGAGAGCTATAATAACCTCTACATTACTTACCGACTCAAATTAGT
GTTCTTTTTATTAGTATTTACATTTGATTGAATTGAAAAACTTTACCCAACAGAGCTAATAGCTGAAATCAATTTATGATAGAAGTCTATAGGTCATTTT
GTTTTATCAACATAAAAAAAATTCATTCAACAAAAATATATTATACCAATCAAGAGACTGATTGAAGTGATACTACATATTCTTTAGTCTTCAACTGTTA
AATATTTTCCAACTATTGACACTAAACTGCTAATTTCTATTCCATCTGTGATAATGTGAACACTATTCTTAAATTTTGTACGCTTTTCCTGTTTATACAC
CTCTAACACTTTTTGTAAGTTTCACCTAATTTTTTTTTCCAATTTCATTTAGGCTAATGGGGAGAAGTGCCAAAATTTTTCCTTTGGAAAACCCCTAAAT
TTTTAAACCAAACCATATTGGAAATTTTTCCACAAGGGGGCTCTTTTATCTTTTGGGTTTAGAAAACTGGGGCCAATTTCATAAACAGAAAATTTTTCTC
CCAATAAAATCCTTCGTATTTAACGTCCCCCAAGTAACTTTACTTAATATGATCCGCGGTTATGTGTCTTATACTAACTCAATAGAGATCTTGTAAAAAA
CTTGAATAACATAATTATACATTCATTCTTAACCCTTTTTATCTCCAATGGTCTATAGAAAATTCATCACTTC
>LE_HBa0116G09_SP6_300218 (trimmed for quality and cloning vector)
TGATCAGTCGTGATTCTTTTTAGATATCCGTTGCGTATACATAAAAATGCATCGCCTACTTTATTAATTGGCATTGTTATGTGCTGCTGGCTCCCAACTT
CTATATGCCTATGCTCACATACTACTTACTATGTATTCTCCTCTGAATAGACAATTGCTTCAACCGAATCCCTGTATTAGACACTATTCTGCGAAATGAT
TTACTGTTCTGCCACTTGATTTGTTATTATCGTTTATCTCCCTTTACAAGTCTGAGAGCTATAATAACCTCTACATTACTTACCGACTCAAATTAGTGTT
CTTTTTATTAGTATTTACATTTGATTGAATTGAAAAACTTTACCCAACAGAGCTAATAGCTGAAATCAATTTATGATAGAAGTCTATAGGTCATTTTGTT
TTATCAACATAAAAAAAATTCATTCAACAAAAATATATTATACCAATCAAGAGACTGATTGAAGTGATACTACATATTCTTTAGTCTTCAACTGTTAAAT
ATTTTCCAACTATTGACACTAAACTGCTAATTTCTATTCCATCTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.929724
Expected error %
0.384498
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0116G09
Clone
Clone name
hba-116g9
LE_HBa0116G09
C03HBa0116G09
P116G09
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found