Clone Read LE_HBa0116I06_SP6_300307

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0116I06_SP6_300307
Primer
SP6
ID from Seq. Facility
LE_HBa_116_I06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
219 trimmed for vector and quality, 961 raw
Sequence
>LE_HBa0116I06_SP6_300307 (raw untrimmed)
CAGATGCAAGACTGCGCAATAGTGGGGACAGGAATGGTCCACCTACGGTGGAGGCGTCAGGCGCCAAACTAAATATCGATCCGGGCACGATGCCTGGCGT
CTACAATAAATTCCAAACCTGAGGATGTACCACCACAACCTCAAAAGCTGCCGA
CAATGAATCAGGACTTGTTCTACATTTCCATACAGAGAAAACACCA
ACTAAATTACTCTTGTTGCTTGCCAAATAAGAAACACACGTTCCTTGATACCTCAGGGCACCGAATTATGTGGAAAAGTAACCCATCTCATTGACCTCCA
ATGTGGGACTTTTGTCATTCTTTAACAATATCCATATATATACTACATTTAAGTGTAGTCCCCTTCCAAAAGTGTTACAATCTGGGAAACCTATTTGCAT
TTTTTGTTACGAATAGTGTAAACAATACAAATATCTTGTCTATCCGAACACTTTTATTCACACCAAATTAATACAATCCTAGGCAAACTCGTCATAATAT
TACTATAACTGTACCTGCTTGCCACTAAAGCAATCCTATGATTATAATCCTTCCACACTTGTACACGATATGGGAATATCTAACATCTTTTCGACTGTAA
CTTAAAATTAAAAAATTATATACACCACATCTACCCTTTTAAATCGATAGATTTTTCTTACAGAAATTTACAGTTAAAAATTCAACTTAATTCACAAGCC
TCTATTATCATTATGTTATCACACGAGAAATCTCGACATTATGTTCTCTAAATTGCATCTTCACTTACACTGATATTTCGCACAAAACATACTGGGTTCA
TTACAGTTGATAGATCATCACACAAAACATATTTTAACTGTGACTTAAATCTAACTCTTTTCTGTAATCAGATTTTATATGTTATTTACCTTATATATTA
TATATATATATGCCACTTATTCGAAGTACTTATGATGAATAGTTCGACTCCTTTATATTCA
>LE_HBa0116I06_SP6_300307 (trimmed for quality and cloning vector)
CAATGAATCAGGACTTGTTCTACATTTCCATACAGAGAAAACACCAACTAAATTACTCTTGTTGCTTGCCAAATAAGAAACACACGTTCCTTGATACCTC
AGGGCACCGAATTATGTGGAAAAGTAACCCATCTCATTGACCTCCAATGTGGGACTTTTGTCATTCTTTAACAATATCCATATATATACTACATTTAAGT
GTAGTCCCCTTCCAAAAGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.935492
Expected error %
0.816887
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0116I06
Clone
Clone name
hba-116i6
LE_HBa0116I06
P116I06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found