Clone Read LE_HBa0163O04_SP6_301265

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0163O04_SP6_301265
Primer
SP6
ID from Seq. Facility
LE_HBa_163_O04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
316 trimmed for vector and quality, 902 raw
Sequence
>LE_HBa0163O04_SP6_301265 (raw untrimmed)
GAGCGGGCCAATCACCAGATTTCTTGATTATAACAAAAAGACTTGCGAGATTCAAACAGGTAAACTAACACACAATATATGCATTATCAAGCAAGCCTAA
CTAGCTTGTAAATGAATATCTTAAACTTATACTAACATATATATATATATATATCAATGTATGTGTTCATCGGTTATATAGCCTAAAAGGCCAGGGTATT
TCTCCCCAAAACCAAAGGAGAAGACACCTTTTTCAGCCTCACTATAGGCTGCTCAACTCAAAGGGAGTCCTAACTTTTCTTTTAGAATGTTCACTCAATA
AATCTTCACATCCTTGCCCAGATAACAATTTTCCTTAATATAATTACCCTGTAAATGTTCAAACACTCCCCCCAATCCCACCCCTATTTCATCTATGAGA
TACCACTCTCCCGAAAGGCTGCCACACAAAATAGGCACTATCACTCTATTAACTATACAAACTTGGGGTCAGATATGTGAATCCTCCTCGACCATTTTAC
TCAATTCATGACTCGAATCATTCCAAAACTACTTCGCATAAGAATACTTTACCATATAGAGAATGAAACCTTTACATTAATCCAATCTTTTTAAGGAGTG
CCAATTTAAAAAGAACCACCCCTTTATAGTAAATCGCCATTTATCACCCAAAAAATTCTAAGAACCCAAACCCCCATGGTTTTATTAAACCAATGATAAA
ACTTCTAGACCAGGATTTTAAAAGAAACTAAAAATAGCCCCTTCCCCCCTTCCTTACTTAAAACCCATTAAATGCTCCCCCACCAAATTATAAAAACTTT
CGGGCCATAAATTGAACTGTTTCCCCGTTATCTCCCTGAATATTGAACTCCCAAATTGCATAATCCCTAACTCAAAATAATAAAATTTTCTTCCCATTAA
AG
>LE_HBa0163O04_SP6_301265 (trimmed for quality and cloning vector)
GTAAACTAACACACAATATATGCATTATCAAGCAAGCCTAACTAGCTTGTAAATGAATATCTTAAACTTATACTAACATATATATATATATATATCAATG
TATGTGTTCATCGGTTATATAGCCTAAAAGGCCAGGGTATTTCTCCCCAAAACCAAAGGAGAAGACACCTTTTTCAGCCTCACTATAGGCTGCTCAACTC
AAAGGGAGTCCTAACTTTTCTTTTAGAATGTTCACTCAATAAATCTTCACATCCTTGCCCAGATAACAATTTTCCTTAATATAATTACCCTGTAAATGTT
CAAACACTCCCCCCAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.92434
Expected error %
1.70164
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0163O04
Clone
Clone name
hba-163o4
LE_HBa0163O04
C12HBa0163O04
P163O04
Clone type
BAC
Contamination
none
Estimated length
144,268
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found