Clone Read LE_HBa0175B10_SP6_302116

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0175B10_SP6_302116
Primer
SP6
ID from Seq. Facility
LE_HBa_175_B10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
409 trimmed for vector and quality, 1005 raw
Genbank Accession
Sequence
>LE_HBa0175B10_SP6_302116 (raw untrimmed)
NNNCCACTCCTTATTTCACTTTAGTTCTCCTAAACTCTTAGGATCACGATAGGAATTTCATAGCTTGTAAAATAGGCTAAGGATCAGGTGGGATATATTT
TGGTATACTTTAGTGACTTGCTGCCCTCCTTGACATATCGGCTAACCGTACCACCTGTTTGTCATTTTATTTTGCCCAATTTCTCAATTTTCTTTTAATC
TTTATGTTTTCCCTTTCTTATCCATATATATAAGTGACTTTTTTTTAATCACTTATTTTTTGTTCTTTCTTTCTCTTCATTCTTTCAACCCCACTTTTTG
GAGTATTCCTTATAACAACCATCCTCAACTCATGACTTTGCCATGATTCAAGGTTCACAATACCCACGGTTGGGTTAGGGCCACCACAAGGTTGTTTTCT
GCATTAATCAACCTCAACTTGTGCTTTTGGCATAAACTGAGGTGCAGATGTCTAAGGAGGGACCCGGGTTAACACATTGTTCCCAGAGAAGATCATTTGG
GGTGAAAAAAAAAGATTTGTTTTTAAACTCAAATCATTTGGATCGATACGGGATTAACTTCATATGGTTTTCCGGATAAGAGATAAATAGATACATACAT
AAATCTATATACTCTTTTTATCTACTAAAAAATTGCTTTTTTCAAACAAAGGCCAATAATCCTTACCTAACATATCTCTTTTCCCATCATTGTAAAAAAA
CCATAAACAAAGGAAAATTCCAGTCTAATTTTCAAATGGAGGCATTCCCACTGAAATTTATCTAACGGTACTTTTAATGTCACTTTACTTCTACCATTAC
TTTATAAACATCTTACCTCCAAACATCCAATTTTATGAATTTCGTCCTTTATTACATCCTCTACATATAAGTGTGCATAATATCATCTTATTTAACTATC
AATATCTCCCAATCATTCTCTACCTTACCCATCTCTCATATACTCAATCATATAACAATGCTTTGACACCCCATGTACACCCCAATATCTACAATCATCA
TGTAC
>LE_HBa0175B10_SP6_302116 (trimmed for quality and cloning vector)
CTCTTAGGATCACGATAGGAATTTCATAGCTTGTAAAATAGGCTAAGGATCAGGTGGGATATATTTTGGTATACTTTAGTGACTTGCTGCCCTCCTTGAC
ATATCGGCTAACCGTACCACCTGTTTGTCATTTTATTTTGCCCAATTTCTCAATTTTCTTTTAATCTTTATGTTTTCCCTTTCTTATCCATATATATAAG
TGACTTTTTTTTAATCACTTATTTTTTGTTCTTTCTTTCTCTTCATTCTTTCAACCCCACTTTTTGGAGTATTCCTTATAACAACCATCCTCAACTCATG
ACTTTGCCATGATTCAAGGTTCACAATACCCACGGTTGGGTTAGGGCCACCACAAGGTTGTTTTCTGCATTAATCAACCTCAACTTGTGCTTTTGGCATA
AACTGAGGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.940037
Expected error %
0.163976
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0175B10
Clone
Clone name
hba-175b10
LE_HBa0175B10
C03HBa0175B10
P175B10
Clone type
BAC
Contamination
none
Estimated length
116,569
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found