Clone Read LE_HBa0196K21_SP6_302869

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0196K21_SP6_302869
Primer
SP6
ID from Seq. Facility
LE_HBa_196_K21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
550 trimmed for vector and quality, 927 raw
Genbank Accession
Sequence
>LE_HBa0196K21_SP6_302869 (raw untrimmed)
ATATCAGCTTATGTATGTCATGAATTGTACATGACCAGACATAGCTTGCGCTATCAGTAAACTAAGTCGATACACAAGTAATCCTAATCAAAGTCATTGG
TTGACAATGAAGAGAGTTTTGAGGTACTTAGATGACACTCAAAACTATGCTTTATATTACAACAAATATCCAGTCGTTCTTGAAGGATATAGTCATGCAA
AATTGGATTACTGGGTCAACTAAAACAAAATTCACAAGTGGATACGTTTTTCTATTGGTGAAGGAGCAATATCTTGGAAATCATCCAAACAAACATATAT
AGCTCGCTCTACAATGGAGTCTGAATTCATTTCTTTACACAAGGTAGGTGAAGTTTAATGGCTCTGGAATTTCTTAGAAGATATTCCATTTTGGCCCAAA
CCAATGGCCCCTATATGCATACACTGTGATAGTCAAGCTATAATAGGATGGGCTCGAAGCATTATGTATAATGGCAAGTCTCGTCACATAAGACGAAGAC
ATAACTATGTGAGACAACTACTCTAGTGGAATTATCACAATTGACTATGTGAAGTTCAAAAGATAATGTGTCGTATCCCCCTACAAAAGGCCTAGCTAGA
GAGGGGAGTTGAGAAATCATCGACGGGAACAGACTATGGACAAGAACAAGTTCTTGTGGCGGTAAATCCTCCTAATAAAAATTGGAGATCCCAAAAATCT
GGTTTCAAGGAGAAAAACCCAAATTCTTTGGACACTTTTTTTAATTTCTTCAAAAAAAAAAATATTATTTTAAGGGTTCCATTTACCCTTAAGAGTAACA
TTTTTTTAATTCCCCACTTTAAAGAATCCATACGGATTTTTTTTAATGTGTTCCCTACAATTGTGTAAACCGGGAAATTTCCCAATGGTGGGTTCACTTT
TGGGTATTACTTACCCTTTAACAAAAG
>LE_HBa0196K21_SP6_302869 (trimmed for quality and cloning vector)
TCAGCTTATGTATGTCATGAATTGTACATGACCAGACATAGCTTGCGCTATCAGTAAACTAAGTCGATACACAAGTAATCCTAATCAAAGTCATTGGTTG
ACAATGAAGAGAGTTTTGAGGTACTTAGATGACACTCAAAACTATGCTTTATATTACAACAAATATCCAGTCGTTCTTGAAGGATATAGTCATGCAAAAT
TGGATTACTGGGTCAACTAAAACAAAATTCACAAGTGGATACGTTTTTCTATTGGTGAAGGAGCAATATCTTGGAAATCATCCAAACAAACATATATAGC
TCGCTCTACAATGGAGTCTGAATTCATTTCTTTACACAAGGTAGGTGAAGTTTAATGGCTCTGGAATTTCTTAGAAGATATTCCATTTTGGCCCAAACCA
ATGGCCCCTATATGCATACACTGTGATAGTCAAGCTATAATAGGATGGGCTCGAAGCATTATGTATAATGGCAAGTCTCGTCACATAAGACGAAGACATA
ACTATGTGAGACAACTACTCTAGTGGAATTATCACAATTGACTATGTGAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95897
Expected error %
0.268499
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 70 E Value 1e-12 Identity 9.20% Align. Length 512bp (93.09%) Frame 3
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38766.1| Score 243 E Value 9e-64 Identity 69.80% Align. Length 543bp (98.73%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89783.1| Score 188 E Value 2e-47 Identity 62.80% Align. Length 543bp (98.73%) Frame 3
putative retrovirus-related pol polyprotein-like [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0196K21
Clone
Clone name
hba-196k21
LE_HBa0196K21
P196K21
Clone type
BAC
Contamination
none
Estimated length
77,192
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found