Clone Read LE_HBa0097P15_T7_30317

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0097P15_T7_30317
Primer
T7
ID from Seq. Facility
LE_HBa_097_P15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
702 trimmed for vector and quality, 812 raw
Genbank Accession
Sequence
>LE_HBa0097P15_T7_30317 (raw untrimmed)
CTGGTTCCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTACTTAAATTTTCAGCATATTTCCATGTCCTTGAAACTCAATTCAGTCAAA
CATTTAGTTTTTAGTGGTAGGGTTTGCATCTCTTTCCCTCCATTTCATCTAGTTAAGTCTTCATTCGAGGACGAATGTTTCGGGGAAAGATGATTTAACA
CCTCGTATGTTGGAACCACGAAAGTGCAGAAAATCTGGAGGTATAGCGACCATCTACGGACATCACCCATGGACCGCAAGGTGACCCACAGTTCGTGTTA
GTGGTCCCTGGGGGGCCACTTGCAACTCCTCTCAGAACTAGTCTAGAAAAATAGCTAGATTGTCGACCAATGCTGAACCTATGGTCCATAGGCCCAGGCC
ACAGTCTTTGTTCTGGGTCAGTAGGTCAAACCCCAAAAACTACCTTCAATCACAACAGACGATTCACCAGCATGGGTTATCAATCCATTGATGGTCCGTT
GGTGATCCCGACATTAGTTAAGTCAAGGGTTTTTTGGTCTTTTCCTATTTCATTGGACCCCTAAACTACGTTGTTTAACCCCTAAACTATGTGGTTTTAG
TTAGTTTCAGCCTAGAAAAAGGACTAGAACATATCTAAGTCAAATCATTCTTCAGGACTTAGAAAAATAGAGCATAAAGTAGAAAGAATTCAATAATGCA
ACAAGAATTCATCAGTATTAGCCCAAAAAACGAAAGCTTTCTTTTGAGAAATTCGTTCACCAGACATATGGGAATTTCACTAATGGGGTTCCCTTTCTTC
CATTAAATCCCC
>LE_HBa0097P15_T7_30317 (trimmed for quality and cloning vector)
AGCTTGTACTTAAATTTTCAGCATATTTCCATGTCCTTGAAACTCAATTCAGTCAAACATTTAGTTTTTAGTGGTAGGGTTTGCATCTCTTTCCCTCCAT
TTCATCTAGTTAAGTCTTCATTCGAGGACGAATGTTTCGGGGAAAGATGATTTAACACCTCGTATGTTGGAACCACGAAAGTGCAGAAAATCTGGAGGTA
TAGCGACCATCTACGGACATCACCCATGGACCGCAAGGTGACCCACAGTTCGTGTTAGTGGTCCCTGGGGGGCCACTTGCAACTCCTCTCAGAACTAGTC
TAGAAAAATAGCTAGATTGTCGACCAATGCTGAACCTATGGTCCATAGGCCCAGGCCACAGTCTTTGTTCTGGGTCAGTAGGTCAAACCCCAAAAACTAC
CTTCAATCACAACAGACGATTCACCAGCATGGGTTATCAATCCATTGATGGTCCGTTGGTGATCCCGACATTAGTTAAGTCAAGGGTTTTTTGGTCTTTT
CCTATTTCATTGGACCCCTAAACTACGTTGTTTAACCCCTAAACTATGTGGTTTTAGTTAGTTTCAGCCTAGAAAAAGGACTAGAACATATCTAAGTCAA
ATCATTCTTCAGGACTTAGAAAAATAGAGCATAAAGTAGAAAGAATTCAATAATGCAACAAGAATTCATCAGTATTAGCCCAAAAAACGAAAGCTTTCTT
TT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.976318
Expected error %
0.50895
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0097P15
Clone
Clone name
hba-97p15
LE_HBa0097P15
C07HBa0097P15
P097P15
Clone type
BAC
Contamination
none
Estimated length
131,233
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found