Clone Read LE_HBa0006P10_SP6_3042

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006P10_SP6_3042
Primer
SP6
ID from Seq. Facility
LE_HBa_006_P10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
763 trimmed for vector and quality, 950 raw
Genbank Accession
Sequence
>LE_HBa0006P10_SP6_3042 (raw untrimmed)
AAAAAAAAAAGGTNTNCNNCCTCGATTTACNCATCNCTNCAGCNTGCCCGTGTCNTGCTGCANGTACTGGGCTTTTGCAGGTTTGCCACATTAAAGGAGA
GAAAAAAGAATGCAGTGTGATGATCTCACCTTACTGATTTGTCTTGTTGGCAGGATTTTACTGGTGTACCAGCTGTGGTGGACCTTGCTTGCATGCGTGA
TGCCATGAACAACCTTGGCAGTGATTCTGACAAGATTAATCCATTGGTATGATACTTTATAGTTAGTGAATTGTGGCTAAGTCTCTTGAACTATGCAAAA
AGAATGCAGTGAAGTCTATACTTCAGTTCATAAGCATTGAATTGCATATGTTGTCTCATTCATTGCTCACACTTATATGCTTAAGTTTCTTGGTTACTGT
TCTCTTAAGTCTTCTCGTGAATGACTATCATACCATTTCATGGTGATTTTTTTTTTGGGAATATCATTTCAGGTTCCTGTCGACCTAGTTATTGATCACT
CAGTTCAAGTTGATGTAACAAGGTCAGAAAATGCAGTCCAGGCTAATATGGAGCTTGAATTCCAAAGGAATAAGGAGAGATTTGCCTTCCTTAAGTGGGG
ATCCAATGCTTTCCAAAACATGCTTGTTGTTCCACCTGGGTCTGGTATTGTGCATCAGGTATTGTACCTGAAAACTGAATGTGACTTAGCTGCTTGTGCT
TCTGGATTTGGTCAATGTGATAGTTGTGCTGAGCTCTAACTATTTCTTGAATCATGAATTCTTCAGCTTTGCATGCTCTTACTTATCTTCCCTCGTTAGA
GGATTTGGAGTGAGTTTCCACTTCTGAAACAAGGGATTTTGCAAACTGATATATTTTTTCCTATTGTAATTTTAGGTGAATCTTGAATATCTTGGAAAGG
TTGGTGTTCATAGGGAAAGCTTGCTCACCCCGATAGCGTGGTCCGACAAA
>LE_HBa0006P10_SP6_3042 (trimmed for quality and cloning vector)
TGCCCGTGTCNTGCTGCANGTACTGGGCTTTTGCAGGTTTGCCACATTAAAGGAGAGAAAAAAGAATGCAGTGTGATGATCTCACCTTACTGATTTGTCT
TGTTGGCAGGATTTTACTGGTGTACCAGCTGTGGTGGACCTTGCTTGCATGCGTGATGCCATGAACAACCTTGGCAGTGATTCTGACAAGATTAATCCAT
TGGTATGATACTTTATAGTTAGTGAATTGTGGCTAAGTCTCTTGAACTATGCAAAAAGAATGCAGTGAAGTCTATACTTCAGTTCATAAGCATTGAATTG
CATATGTTGTCTCATTCATTGCTCACACTTATATGCTTAAGTTTCTTGGTTACTGTTCTCTTAAGTCTTCTCGTGAATGACTATCATACCATTTCATGGT
GATTTTTTTTTTGGGAATATCATTTCAGGTTCCTGTCGACCTAGTTATTGATCACTCAGTTCAAGTTGATGTAACAAGGTCAGAAAATGCAGTCCAGGCT
AATATGGAGCTTGAATTCCAAAGGAATAAGGAGAGATTTGCCTTCCTTAAGTGGGGATCCAATGCTTTCCAAAACATGCTTGTTGTTCCACCTGGGTCTG
GTATTGTGCATCAGGTATTGTACCTGAAAACTGAATGTGACTTAGCTGCTTGTGCTTCTGGATTTGGTCAATGTGATAGTTGTGCTGAGCTCTAACTATT
TCTTGAATCATGAATTCTTCAGCTTTGCATGCTCTTACTTATCTTCCCTCGTTAGAGGATTTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961133
Expected error %
0.781665
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g35830.1 Score 125 E Value 3e-29 Identity 96.80% Align. Length 510bp (66.84%) Frame 3
68417.m05090 aconitate hydratase, cytoplasmic / citrate hydro-lyase / aconitase (ACO) identical to SP|Q42560 Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase) {Arabidopsis thaliana}; contains Pfam profiles PF00330: Aconitase family (aconitate hydratase), PF00694: Aconitase C-terminal domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g05710.1 Score 124 E Value 4e-29 Identity 96.80% Align. Length 510bp (66.84%) Frame 3
68415.m00611 aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, putative nearly identical to SP|P49608 Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase) {Cucurbita maxima}; contains Pfam profiles PF00330: Aconitase family (aconitate hydratase), PF00694: Aconitase C-terminal domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP30039.1| Score 129 E Value 1e-28 Identity 100.00% Align. Length 510bp (66.84%) Frame 3
aconitase [Lycopersicon pennellii]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|P49608|ACOC_CUCMA Score 127 E Value 4e-28 Identity 32.80% Align. Length 188bp (24.64%) Frame 1
Aconitate hydratase, cytoplasmic (Citrate hydro-lyase) (Aconitase) pir||T10101 aconitate hydratase (EC 4.2.1.3) - cucurbit dbj|BAA06108.1| aconitase [Cucurbita cv. Kurokawa Amakuri]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006P10
Clone
Clone name
hba-6p10
LE_HBa0006P10
P006P10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found