Clone Read LE_HBa0006P10_T7_3043

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006P10_T7_3043
Primer
T7
ID from Seq. Facility
LE_HBa_006_P10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
671 trimmed for vector and quality, 954 raw
Genbank Accession
Sequence
>LE_HBa0006P10_T7_3043 (raw untrimmed)
CGGGCTAATCTGATAGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACTAAAGAGGAAAAAAAAAGAACTTTTGTGACATTATACAAAGAAC
TATAATTTAAAAAAGGAAATTTGAAGTTGTTACAATTAGAAAGAAATGAGATCATCTAAATAAAGAAAAGGACAAACATAGTTGCAATATTTGTCAAAGC
TGGAAACCTCCGTTGCCTCGATATCAACACCTTTTGGGCAATTGCTTCAATTTTATCTTCATCAATCAGGATAAGTAAATACTGTAGATAAGGTCTAAAT
TATTCAGCAAAATGATGTGGAAAATATTTTTTTTTTTTAATATTTTTTTTCCTTATCCTTCACTTGTCATTTGGTATTAGTTTTAACAACTTTACTAGTA
TAAATTGAGCCTCTTTGCCTCGACCATTTGCATACACAATTCATCATTTGCAATTGTATAGGTACTACACAAAATAAAAAAAGATTAAAAGTTCTAGCCA
TGGCTGCATCTTACTCAGTTCCTTCAATGGTAAGATCATCTCTTATCTCACTATCTTGAGATTTTTTTGATATATATATATAGATGGATTTTAATGGACC
GCTTATTAATTGAAACATTTTTTATTTTCTTTATGTACATTTGATATCGTTAGTTATTTTGAATTATAGTATATACTTTTCAAGTATATTTATTAGATTC
TTGAAATTCGATCCTTGTCAAATTATGGAAAAAAAAAGGATTTTTGAAGCAAAAGGTAGCAAAGGTGGCAAGCATGGTGGAACACAAAAAGGTCAGGGTT
AAAAAGAGGGCTTATCAGCTAGGGATGTGGGGCATAAAAAGACTATGAGGGAAGTTATGCCTCCATGATTTGTTCAAAGCATTGGAGGAATCAAAATTAT
CAACTAATGGACACTTTAAGGATTTGGGGACTTAACCGGTCATTTTAAGAGGGT
>LE_HBa0006P10_T7_3043 (trimmed for quality and cloning vector)
CTCTAGAGTCGACCTGCAGGCATGCAAGCTTACTAAAGAGGAAAAAAAAAGAACTTTTGTGACATTATACAAAGAACTATAATTTAAAAAAGGAAATTTG
AAGTTGTTACAATTAGAAAGAAATGAGATCATCTAAATAAAGAAAAGGACAAACATAGTTGCAATATTTGTCAAAGCTGGAAACCTCCGTTGCCTCGATA
TCAACACCTTTTGGGCAATTGCTTCAATTTTATCTTCATCAATCAGGATAAGTAAATACTGTAGATAAGGTCTAAATTATTCAGCAAAATGATGTGGAAA
ATATTTTTTTTTTTTAATATTTTTTTTCCTTATCCTTCACTTGTCATTTGGTATTAGTTTTAACAACTTTACTAGTATAAATTGAGCCTCTTTGCCTCGA
CCATTTGCATACACAATTCATCATTTGCAATTGTATAGGTACTACACAAAATAAAAAAAGATTAAAAGTTCTAGCCATGGCTGCATCTTACTCAGTTCCT
TCAATGGTAAGATCATCTCTTATCTCACTATCTTGAGATTTTTTTGATATATATATATAGATGGATTTTAATGGACCGCTTATTAATTGAAACATTTTTT
ATTTTCTTTATGTACATTTGATATCGTTAGTTATTTTGAATTATAGTATATACTTTTCAAGTATATTTATT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.918614
Expected error %
0.299193
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|L38948.1:25-452 Score 64 E Value 2e-11 Identity 100.00% Align. Length 31bp (4.62%) Frame 2
Cloning vector pKIL128 ccdB gene, complete cds
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|U13871.1:182-319 Score 64 E Value 2e-11 Identity 100.00% Align. Length 31bp (4.62%) Frame 2
pT7T3D cloning vector
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006P10
Clone
Clone name
hba-6p10
LE_HBa0006P10
P006P10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found