Clone Read LE_HBa0006P14_SP6_3050

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006P14_SP6_3050
Primer
SP6
ID from Seq. Facility
LE_HBa_006_P14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
720 trimmed for vector and quality, 948 raw
Genbank Accession
Sequence
>LE_HBa0006P14_SP6_3050 (raw untrimmed)
AAAAAAAAAAGGGTTTNCCATAACTTAGTACTCANNNNGNNNNNANANNNNNNNNNNNNNGNANGNGGNNNNNNNAANNNNANANGCCTTTTGAGGCANC
NCNGAGCGAAANGGGAAGCACAANCCAGGGTTAAA
CTTTTAGTTTTCTGTTTATATTGATACGTGCTACTCGCTGCTTACCTTTCATTTGGCAGGTTCTG
ATGTATTAACTCGCCTTTTACTTTTGGTTTGTGAAGTTTCTGCATTTCATTTTAGGGACTTGAACATAAAGAGTTTAACTTCTTGTGGCCTTTGGTACTT
GAAAGTTGTAACAAGAAATAAGTCATAATTTAGCCACGACCAATAACTTCTAGGCATAGTGAACTAATGAGAGCTACTTCAGACAAAGGCTGTCAAAGAT
GCAACTTCCTCCAAGTCTTCTTATTTTATTTCTATTGCTAAGACTTATTAGGTGTCTCCTAATTCTGCAATAACATCAATCTCTGCTTCATTTGTCTTTC
AGGGTAAGACCTGCATCAAGTGTCAGTAAGAGTGTTGCTGCCCTTCCCCTCTCTGGGAAGGAAAAATCAGCGAAGCCTCCAAGACGGCTGTCTGTTCCCT
CCAAGTCAATTGTCAGCCCTGCTTCTAGACCACTTGGTATTATAACCAAGGAACCAAAAAAAATAGGCAAACCCATTTCTGAGACTAGAGCAAAGAGATC
TCCTAGTAACCAAGGAAAATCGGATACACCACAATCAAATGTTTCAAAGTCCTCAAATAGAAAGAAATATGACCTTATATCCTCAGCTTCTTATTGGCTA
TCACAGATTAAGCTTTCTGAATCTGCTGCTAAGCATTCAATTTCCCTGGGCTTGTTCAAACTTGCTTTGGAGGCTGGTCTGAGGTATGATATATATCTCT
CCCACATGAATTTAACTCTACTTGAAAAATAGTGAGCTCATTGAAATG
>LE_HBa0006P14_SP6_3050 (trimmed for quality and cloning vector)
CTTTTAGTTTTCTGTTTATATTGATACGTGCTACTCGCTGCTTACCTTTCATTTGGCAGGTTCTGATGTATTAACTCGCCTTTTACTTTTGGTTTGTGAA
GTTTCTGCATTTCATTTTAGGGACTTGAACATAAAGAGTTTAACTTCTTGTGGCCTTTGGTACTTGAAAGTTGTAACAAGAAATAAGTCATAATTTAGCC
ACGACCAATAACTTCTAGGCATAGTGAACTAATGAGAGCTACTTCAGACAAAGGCTGTCAAAGATGCAACTTCCTCCAAGTCTTCTTATTTTATTTCTAT
TGCTAAGACTTATTAGGTGTCTCCTAATTCTGCAATAACATCAATCTCTGCTTCATTTGTCTTTCAGGGTAAGACCTGCATCAAGTGTCAGTAAGAGTGT
TGCTGCCCTTCCCCTCTCTGGGAAGGAAAAATCAGCGAAGCCTCCAAGACGGCTGTCTGTTCCCTCCAAGTCAATTGTCAGCCCTGCTTCTAGACCACTT
GGTATTATAACCAAGGAACCAAAAAAAATAGGCAAACCCATTTCTGAGACTAGAGCAAAGAGATCTCCTAGTAACCAAGGAAAATCGGATACACCACAAT
CAAATGTTTCAAAGTCCTCAAATAGAAAGAAATATGACCTTATATCCTCAGCTTCTTATTGGCTATCACAGATTAAGCTTTCTGAATCTGCTGCTAAGCA
TTCAATTTCCCTGGGCTTGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957702
Expected error %
0.192966
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g62550.1 Score 80 E Value 9e-16 Identity 14.80% Align. Length 350bp (48.61%) Frame 1
68418.m07850 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD32903.1| Score 106 E Value 5e-22 Identity 17.70% Align. Length 350bp (48.61%) Frame 1
unknown protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB11505.1| Score 80 E Value 4e-14 Identity 14.80% Align. Length 350bp (48.61%) Frame 1
unnamed protein product [Arabidopsis thaliana] ref|NP_201061.1| expressed protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006P14
Clone
Clone name
hba-6p14
LE_HBa0006P14
P006P14
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found