Clone Read LE_HBa0006P14_T7_3051

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006P14_T7_3051
Primer
T7
ID from Seq. Facility
LE_HBa_006_P14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
769 trimmed for vector and quality, 964 raw
Genbank Accession
Sequence
>LE_HBa0006P14_T7_3051 (raw untrimmed)
GGCCCTAACTGGGACCCGGGGTATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGATGTTCTTAGCGATCCACCCATTCGGGGGATCTACGATCTAT
ACGGTGAGGAGGCGTTGACTTTGGGTCAGGTGCCACCTCCTCCAAGAGGTGGACCCCACAACATGCGGAATCCTCATCCTAATCCTTCGTTCCGGTTTAA
TCCTAGAGATGCTGATGATATTTATGCGGAATTGTTTGGGGCATCGTCATCGGAGAATAATGGGAGGGCGAGGAAGACTCGAGATGGGTTTTTTAGGAGT
ACCACGAATGGAGGGGCTGAGTTTTCCGGTGCTGGGAACTCCAGTACCGGAGGGTTAAGAAAGGCTGCGCCAGTGGAGAATGCATTGTTGTGCCGTTTGG
AGGATTTGTATAAAGGGGCCAAGAAAAAGATGAAAATTTCTAGGACTGTCTTGGATTCTTCCGGGTATGTTCAATTTGTCTGCACTAATTGTTGCAAATT
TCTTGGTATTTGTAATGCTGTATGTTGCTGATGAATCAGGTTACTCTTGCTGATTATATTTTTATTGAGAAATTCTTTGTGCATTTTGTTAAAGATTGGA
TTTTTCATTTATCGAGTAAGTATATGTGCATTTTGAGAATTTCATAAGAGCAGTGCATGGGGATGTGTATGTTTTTAGGCTACTTTATCTGCTGTTATAA
CTTCACGAGAGCATTTTCAAAGTTGAATGAGGTTTGGGTGCGCATCACAATGAAATTTCTTTTCATGCCTAGTTTGTTGGTTAATATCTGGTGTGGGTGA
CTTGGCATTGGTGAGATTGAAATACTTTGCTGAATGCATTAAAACATTAGAATTTTAGTGCAGAGTTATCTTTACATGATGGAGAAGTACTTGCTTAGGA
AAAATACCCCCCTTTTGAAGTTTGAAAAATGTCAAATGGGTTGGATTCTTTTATTTTTTTTGGA
>LE_HBa0006P14_T7_3051 (trimmed for quality and cloning vector)
AGCTTATGATGTTCTTAGCGATCCACCCATTCGGGGGATCTACGATCTATACGGTGAGGAGGCGTTGACTTTGGGTCAGGTGCCACCTCCTCCAAGAGGT
GGACCCCACAACATGCGGAATCCTCATCCTAATCCTTCGTTCCGGTTTAATCCTAGAGATGCTGATGATATTTATGCGGAATTGTTTGGGGCATCGTCAT
CGGAGAATAATGGGAGGGCGAGGAAGACTCGAGATGGGTTTTTTAGGAGTACCACGAATGGAGGGGCTGAGTTTTCCGGTGCTGGGAACTCCAGTACCGG
AGGGTTAAGAAAGGCTGCGCCAGTGGAGAATGCATTGTTGTGCCGTTTGGAGGATTTGTATAAAGGGGCCAAGAAAAAGATGAAAATTTCTAGGACTGTC
TTGGATTCTTCCGGGTATGTTCAATTTGTCTGCACTAATTGTTGCAAATTTCTTGGTATTTGTAATGCTGTATGTTGCTGATGAATCAGGTTACTCTTGC
TGATTATATTTTTATTGAGAAATTCTTTGTGCATTTTGTTAAAGATTGGATTTTTCATTTATCGAGTAAGTATATGTGCATTTTGAGAATTTCATAAGAG
CAGTGCATGGGGATGTGTATGTTTTTAGGCTACTTTATCTGCTGTTATAACTTCACGAGAGCATTTTCAAAGTTGAATGAGGTTTGGGTGCGCATCACAA
TGAAATTTCTTTTCATGCCTAGTTTGTTGGTTAATATCTGGTGTGGGTGACTTGGCATTGGTGAGATTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.966151
Expected error %
0.554409
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g20560.1 Score 129 E Value 2e-30 Identity 18.40% Align. Length 413bp (53.71%) Frame 3
68415.m02401 DNAJ heat shock family protein SP|Q9UDY4 DnaJ homolog subfamily B member 4 (Heat shock 40 kDa protein 1 homolog) {Homo sapiens}; contains Pfam profile PF00226: DnaJ domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g47940.1 Score 114 E Value 8e-26 Identity 17.10% Align. Length 413bp (53.71%) Frame 3
68416.m05227 DNAJ heat shock protein, putative similar to SP|O89114 DnaJ homolog subfamily B member 5 (Heat shock protein Hsp40-3) {Mus musculus}; contains Pfam profile PF00226: DnaJ domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM63509.1| Score 129 E Value 8e-29 Identity 18.40% Align. Length 413bp (53.71%) Frame 3
putative heat shock protein [Arabidopsis thaliana] gb|AAM91474.1| At2g20560/T13C7.15 [Arabidopsis thaliana] gb|AAD25656.1| putative heat shock protein [Arabidopsis thaliana] gb|AAL09794.1| At2g20560/T13C7.15 [Arabidopsis thaliana] ref|NP_179646.1| DNAJ heat shock family protein [Arabidopsis thaliana] pir||G84590 probable heat shock protein [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB41145.1| Score 114 E Value 4e-24 Identity 17.10% Align. Length 413bp (53.71%) Frame 3
heat shock-like protein [Arabidopsis thaliana] gb|AAN15508.1| heat shock protein-like protein [Arabidopsis thaliana] gb|AAM97012.1| heat shock protein-like protein [Arabidopsis thaliana] ref|NP_190377.1| DNAJ heat shock protein, putative [Arabidopsis thaliana] pir||T06689 heat shock protein homolog T17F15.190 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006P14
Clone
Clone name
hba-6p14
LE_HBa0006P14
P006P14
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found