Clone Read LE_HBa0098F24_SP6_30622

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0098F24_SP6_30622
Primer
SP6
ID from Seq. Facility
LE_HBa_098_F24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
615 trimmed for vector and quality, 782 raw
Genbank Accession
Sequence
>LE_HBa0098F24_SP6_30622 (raw untrimmed)
TTTGCTTCTATGCACGGGAGTACACCTGTAGATATGTGTTGTGCTGCTGCAACCCTAGGCTTTACAACCTCACCCTTAGCTATGACAAGGGTATTCGGAA
CGCTACCATGAGTCTGCTTGGAGGAGAAAAAGGGGATTATGATGAAAGTTGAGATCGCCTTCGCAGTGATGTAAGAGAAAAATGAGATGACGAAGGATGT
GATGATAATAACTATAACACAGAGTATGGAATTTAAAGCAAAAACTGAACAAAGAAATACTCTTGGTACTTCCAAGCTCTTTACTAGCAACCTTATAAAA
ATATTATCAAGGTCAATCTAACATGTTTACCATCATGAAAACATAACATATAAATGTCAAATAGAAACTTCCCTGTTTGGATTACATTCAGGCATTCACT
ACGTCTTGTTCCTGTTCATATTTAGGCTGAGTTTTTGTCAAATCTTTTGGCATGAAGAAGAATAATCCATCCTTCTTTCCAATGTTCCATGAACCACCAT
CAACATGGGAAAATTCATGGTAAAGCAACATATATTGACAAGATACCAATTTTTTGCTACAGAAAGATCATTATGCACTTCAAGTCCATACCCGAAGAAA
GAAGTCTATCTGTAACACCTCCAAAATCAAACTTGGAACTTTCAGCAGAAAAAGGTGAACCACGGAGGGGTTTCCGGTCCATCCCCCTCATCATGGTTCA
CACCCCACCTCCAGGTGGTGGACCACGGAACCCTTTACAGGCTGGAGGGACCCCTCATTTCAACGCAGGCTATAACCTTACC
>LE_HBa0098F24_SP6_30622 (trimmed for quality and cloning vector)
ATATGTGTTGTGCTGCTGCAACCCTAGGCTTTACAACCTCACCCTTAGCTATGACAAGGGTATTCGGAACGCTACCATGAGTCTGCTTGGAGGAGAAAAA
GGGGATTATGATGAAAGTTGAGATCGCCTTCGCAGTGATGTAAGAGAAAAATGAGATGACGAAGGATGTGATGATAATAACTATAACACAGAGTATGGAA
TTTAAAGCAAAAACTGAACAAAGAAATACTCTTGGTACTTCCAAGCTCTTTACTAGCAACCTTATAAAAATATTATCAAGGTCAATCTAACATGTTTACC
ATCATGAAAACATAACATATAAATGTCAAATAGAAACTTCCCTGTTTGGATTACATTCAGGCATTCACTACGTCTTGTTCCTGTTCATATTTAGGCTGAG
TTTTTGTCAAATCTTTTGGCATGAAGAAGAATAATCCATCCTTCTTTCCAATGTTCCATGAACCACCATCAACATGGGAAAATTCATGGTAAAGCAACAT
ATATTGACAAGATACCAATTTTTTGCTACAGAAAGATCATTATGCACTTCAAGTCCATACCCGAAGAAAGAAGTCTATCTGTAACACCTCCAAAATCAAA
CTTGGAACTTTCAGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959174
Expected error %
0.408769
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0098F24
Clone
Clone name
hba-98f24
LE_HBa0098F24
P098F24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found