Clone Read LE_HBa0098F24_T7_30623

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0098F24_T7_30623
Primer
T7
ID from Seq. Facility
LE_HBa_098_F24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
789 trimmed for vector and quality, 837 raw
Genbank Accession
Sequence
>LE_HBa0098F24_T7_30623 (raw untrimmed)
GGAAGCTGGGTACGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTCAATTTCAACTATCGGCCATCGAAGCAGCTGATTTCCAGATTTAT
GAAGCCAAATCCTTCTACGAATTCCTTGAAGACCAGCCCATCCTCTCATACTATTAATCTCAAGATTATTAACCGATTCATTAACCCATCCAAATAAAAT
CCTCCTACTAGTAGAACTATCGAAAAAAGTTTTCGATGCATAAAATTTACCATAATCATATCGAAATCCTAATCCAATATCAAGTGATCTGTTATCCGGG
ATAAAAATATCATTAGTCGGATTGTATGTACCAATTGTGTAGTAATCAGTGTTTGCTGTACTTGCCTTGAATACATGTTTCACATTTTGACCTATTGTGG
AAGTTTCTAGACCATTTTTTCTGATCTTTGAAACAGGGAAAAAATCAGGGCATTCCCACATTCCAGAATTGTTCAAAAAATGCAGTGGATTTTCAGCTTG
AATCCAATCAATGAAGTTTTTGCTTCTATACAATAACCCAATTCCGCTCCCGTTTTGTTGATTTCCAACTACCATTCTCCAATTTCCGTCAGGATTTAGC
CAAGCAGTACTTGGATCTCTGAAATTTTGTCCATCAATTTTGTTCACCGAATTCGGTGCGATCAATGGATTATAAGGTGATTTTACCCATTCTGTAAGGT
ACGGGTCAGCTACATTTTTGGGGACTGCTAGATTTTGTACCTGGATACCGGAGAAATCTAAGCCGGTGTAGAGAACTGCCGGTTTTCCGCCAGAGAGAAG
AGTTGTAGAACCGGTAAAACAGCCTTTGAAATCGTAA
>LE_HBa0098F24_T7_30623 (trimmed for quality and cloning vector)
AGCTTTTCAATTTCAACTATCGGCCATCGAAGCAGCTGATTTCCAGATTTATGAAGCCAAATCCTTCTACGAATTCCTTGAAGACCAGCCCATCCTCTCA
TACTATTAATCTCAAGATTATTAACCGATTCATTAACCCATCCAAATAAAATCCTCCTACTAGTAGAACTATCGAAAAAAGTTTTCGATGCATAAAATTT
ACCATAATCATATCGAAATCCTAATCCAATATCAAGTGATCTGTTATCCGGGATAAAAATATCATTAGTCGGATTGTATGTACCAATTGTGTAGTAATCA
GTGTTTGCTGTACTTGCCTTGAATACATGTTTCACATTTTGACCTATTGTGGAAGTTTCTAGACCATTTTTTCTGATCTTTGAAACAGGGAAAAAATCAG
GGCATTCCCACATTCCAGAATTGTTCAAAAAATGCAGTGGATTTTCAGCTTGAATCCAATCAATGAAGTTTTTGCTTCTATACAATAACCCAATTCCGCT
CCCGTTTTGTTGATTTCCAACTACCATTCTCCAATTTCCGTCAGGATTTAGCCAAGCAGTACTTGGATCTCTGAAATTTTGTCCATCAATTTTGTTCACC
GAATTCGGTGCGATCAATGGATTATAAGGTGATTTTACCCATTCTGTAAGGTACGGGTCAGCTACATTTTTGGGGACTGCTAGATTTTGTACCTGGATAC
CGGAGAAATCTAAGCCGGTGTAGAGAACTGCCGGTTTTCCGCCAGAGAGAAGAGTTGTAGAACCGGTAAAACAGCCTTTGAAATCGTAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.9642
Expected error %
0.291081
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g13790.1 Score 309 E Value 1e-84 Identity 17.90% Align. Length 785bp (99.49%) Frame 1
68416.m01742 beta-fructosidase (BFRUCT1) / beta-fructofuranosidase / cell wall invertase identical to beta-fructofuranosidase GI:402740 from [Arabidopsis thaliana]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g13784.1 Score 300 E Value 8e-82 Identity 17.80% Align. Length 782bp (99.11%) Frame 1
68416.m01741 beta-fructosidase, putative / beta-fructofuranosidase, putative / cell wall invertase, putative similar to beta-fructofuranosidase GI:402740 from [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD10960.1| Score 327 E Value 2e-88 Identity 19.20% Align. Length 782bp (99.11%) Frame 1
cell wall invertase precursor [Fragaria x ananassa]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD91338.1| Score 320 E Value 2e-86 Identity 18.90% Align. Length 782bp (99.11%) Frame 1
beta-fructofuranosidase [Glycine max]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0098F24
Clone
Clone name
hba-98f24
LE_HBa0098F24
P098F24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found