Clone Read LE_HBa0098H04_T7_30679

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0098H04_T7_30679
Primer
T7
ID from Seq. Facility
LE_HBa_098_H04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
793 trimmed for vector and quality, 889 raw
Genbank Accession
Sequence
>LE_HBa0098H04_T7_30679 (raw untrimmed)
TTTTTTTTTTTTTTTCCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACCCTAGTAACTATTATATTGACCATTTATTATTAAAAACATGT
ACCCAACTATTTATCTCAACCTGTATGTCGGTCAAACCCCATGAACTTTTCCCCATACTTGATTCCCCTTTTTCATTTTTATCGTTTTTACTTTACTTGT
GAAAACCCACCCTTTGATACTAGAAACTTTTGTGTCGACTCTTTTATTTGACATGTTTTTATTTGAAAATTTATTTACCTATGACTAATTAGAAAAGGAA
TTCTAGTTTATCTACATATTCCCAAAACCGCTCCCTCACGACCCAACCCTTAGTTGGGTTACTAAACTATCGATTATCATAGACACTCATACCATAGGTT
AGTGCCGTTGGTCACAATAAGCATCAGAAATGTTTGAGTTTATTTAGTGATGGATGATCAAGATAAGGTTAGGAGTATTTAAGATAAGATTCTAGCATCT
TAGAGTAGTCAAAAGAAGCATATGGATCATAAGGTAAGAGACATGGCGTTTCGATCCTATGAAAATGTTCTTCTTAAAGTATCACACATCAAAGGGGTTA
TGAGATTTGGTATGAAAGCTAAGCTAAGTCCTAGGAACATTGGTCCCTTTGATATTTCTTGAGTGTGTCGGGCCGGTAGTGTATAGATTAGGTTTACCTA
CTAATCTATCGAGTGTTCATACGATATTTCATGTGTCCATGTTTAAGAGTTATCCATGGTGACCAAGATTATATCATTTAGTGGAACTAAATTGTGTTAG
ACAAGGGACCACCAATATTTAGGAGAAAACTATTCCAATTCTTGATCGTGATTTATGCAACTTTTAGACCTAAGAAATTAAGTCCGTGA
>LE_HBa0098H04_T7_30679 (trimmed for quality and cloning vector)
AGCTTACCCTAGTAACTATTATATTGACCATTTATTATTAAAAACATGTACCCAACTATTTATCTCAACCTGTATGTCGGTCAAACCCCATGAACTTTTC
CCCATACTTGATTCCCCTTTTTCATTTTTATCGTTTTTACTTTACTTGTGAAAACCCACCCTTTGATACTAGAAACTTTTGTGTCGACTCTTTTATTTGA
CATGTTTTTATTTGAAAATTTATTTACCTATGACTAATTAGAAAAGGAATTCTAGTTTATCTACATATTCCCAAAACCGCTCCCTCACGACCCAACCCTT
AGTTGGGTTACTAAACTATCGATTATCATAGACACTCATACCATAGGTTAGTGCCGTTGGTCACAATAAGCATCAGAAATGTTTGAGTTTATTTAGTGAT
GGATGATCAAGATAAGGTTAGGAGTATTTAAGATAAGATTCTAGCATCTTAGAGTAGTCAAAAGAAGCATATGGATCATAAGGTAAGAGACATGGCGTTT
CGATCCTATGAAAATGTTCTTCTTAAAGTATCACACATCAAAGGGGTTATGAGATTTGGTATGAAAGCTAAGCTAAGTCCTAGGAACATTGGTCCCTTTG
ATATTTCTTGAGTGTGTCGGGCCGGTAGTGTATAGATTAGGTTTACCTACTAATCTATCGAGTGTTCATACGATATTTCATGTGTCCATGTTTAAGAGTT
ATCCATGGTGACCAAGATTATATCATTTAGTGGAACTAAATTGTGTTAGACAAGGGACCACCAATATTTAGGAGAAAACTATTCCAATTCTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.954778
Expected error %
1.02978
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31169.1| Score 61 E Value 4e-14 Identity 43.70% Align. Length 354bp (44.64%) Frame 1
putative polyprotein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_472513.1| Score 61 E Value 1e-12 Identity 38.80% Align. Length 303bp (38.21%) Frame 1
OSJNBa0011E07.8 [Oryza sativa (japonica cultivar-group)] emb|CAE04199.2| OSJNBa0011E07.8 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0098H04
Clone
Clone name
hba-98h4
LE_HBa0098H04
C08HBa0098H04
P098H04
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found