Clone Read LE_HBa0098I01_SP6_30720

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0098I01_SP6_30720
Primer
SP6
ID from Seq. Facility
LE_HBa_098_I01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
702 trimmed for vector and quality, 787 raw
Genbank Accession
Sequence
>LE_HBa0098I01_SP6_30720 (raw untrimmed)
GGCGGGATAACAAGCCACCTATAAGATCTATATATAAATCTAAAAGAAAACACCATATGCTAATGCAACAGTGGAAATAACACGATTTACACTTATTTTA
AATTTGTTAGTTGCAATACCAGTTCTAAACAAGAAGCACAAGAATTTAACTTCTATACGTACTTTAACGTTGTAAAATATTTTTTTTTTACACACTATCA
GATCACCAAAAAAAAAATTCTTTTATCAACGGTCATTGCACTTGCTGAGGAGTTGTCTAGCTCGGACAGTAACTTGTAACCGTGCAAGGGCGTGCATGCA
ATGCAGAGCTATCCTTGCTTGTCTTCTCACACATGCCCCTCTCACCACTGCTTGAAGCCTCACAAGGCTCTTGAGTGCCTTAAACGCCCGTCTCGCCTAA
AATATTGAATCAAACAACACATGTATTAATAAATGCGAAATTTCCCATTGAGAAATGTTCAATGTCTATTCCCACAGATATTTTTCACGTGTAAATCGAT
ATGGAAGAAAAATAGTACTGTAGTTATTGTTTCACGTGGAAAAGTAAGTGACAATATGTTTTGCATTTTCTCAGTGAGTTATGTGAAATTAAAGAAGAAT
ATGGTAATTGAGTAAAACTTACAAGATGACCCCTAAAATGAGATTGGATAGTAATAGCAGCCATATCCTCTTTAGACACAAAATAGGTGTGCACATTATT
TTTGTTTGTAGATGAGCGTCCATTGGCGCTGCTGTTCCTATTGGTAATTGTGGTGTTATGAAAAAAAATGATATTTTTTTGGGATCA
>LE_HBa0098I01_SP6_30720 (trimmed for quality and cloning vector)
CTATAAGATCTATATATAAATCTAAAAGAAAACACCATATGCTAATGCAACAGTGGAAATAACACGATTTACACTTATTTTAAATTTGTTAGTTGCAATA
CCAGTTCTAAACAAGAAGCACAAGAATTTAACTTCTATACGTACTTTAACGTTGTAAAATATTTTTTTTTTACACACTATCAGATCACCAAAAAAAAAAT
TCTTTTATCAACGGTCATTGCACTTGCTGAGGAGTTGTCTAGCTCGGACAGTAACTTGTAACCGTGCAAGGGCGTGCATGCAATGCAGAGCTATCCTTGC
TTGTCTTCTCACACATGCCCCTCTCACCACTGCTTGAAGCCTCACAAGGCTCTTGAGTGCCTTAAACGCCCGTCTCGCCTAAAATATTGAATCAAACAAC
ACATGTATTAATAAATGCGAAATTTCCCATTGAGAAATGTTCAATGTCTATTCCCACAGATATTTTTCACGTGTAAATCGATATGGAAGAAAAATAGTAC
TGTAGTTATTGTTTCACGTGGAAAAGTAAGTGACAATATGTTTTGCATTTTCTCAGTGAGTTATGTGAAATTAAAGAAGAATATGGTAATTGAGTAAAAC
TTACAAGATGACCCCTAAAATGAGATTGGATAGTAATAGCAGCCATATCCTCTTTAGACACAAAATAGGTGTGCACATTATTTTTGTTTGTAGATGAGCG
TC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961093
Expected error %
0.0844558
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g51380.1 Score 88 E Value 4e-18 Identity 30.10% Align. Length 152bp (21.65%) Frame 2
68416.m05628 calmodulin-binding family protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB63002.1| Score 88 E Value 2e-16 Identity 30.10% Align. Length 152bp (21.65%) Frame 2
putative protein [Arabidopsis thaliana] ref|NP_190706.1| calmodulin-binding family protein [Arabidopsis thaliana] pir||T45769 hypothetical protein F26O13.20 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_470188.1| Score 81 E Value 3e-14 Identity 25.60% Align. Length 155bp (22.08%) Frame 2
Hypothetical protein [Oryza sativa (japonica cultivar-group)] gb|AAN05500.1| Hypothetical protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0098I01
Clone
Clone name
hba-98i1
LE_HBa0098I01
C02HBa0098I01
P098I01
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found