Clone Read LE_HBa0098I01_T7_30721

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0098I01_T7_30721
Primer
T7
ID from Seq. Facility
LE_HBa_098_I01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
725 trimmed for vector and quality, 900 raw
Genbank Accession
Sequence
>LE_HBa0098I01_T7_30721 (raw untrimmed)
CAAACTGGGTACCCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCCTTTTCTACCAAATCGCATCACCCCTTTCATAGGCGATATCTTCAA
GTAAACCTGGTCACCAACGTTAAATTCTAAGGGTCGCTTTCTGTTGTCTGCATATGACTTCTGTCGGCTATAAGCGGTAGCCAACCTGTCTCTAATCATT
CTAACTTTCTCCAGGGCCTCATGAATGATCTCTGGACCCAAAATAGATGACTCTCCAACCTCGAACCACCCAACTGGAGATCTACACCTCCTACCATACA
ATGCCTCAAATGGTGCCATCCCAATGCTGGAGTGGTAGCTATTATTATACGAGAACTCTATCAAAGGTAGATGGTCATCCCAATTACCTCTAAAGTCAAT
CACACACGCTCTCAACATGTCCTCCAATGTCTGAATAGTGCGCTCTGCCTGCCCATCTGTCTGAGGATGAAAGGCAGTGCTAAGTTTCACCTGCGTGCCT
AAGCTTTTCTGGAAAGATCTCCAAAAATGCGAAGTAAACTGAGCTCCTCTATCTGAAATAATAGACAAAGGAATCCCATGCCATCTCACAATCTCATCAA
TGTAGAGTCTCATGTAATCCTCGGCCCTGTAAGTGGACTTCACAGGGATAAAGTGGGCAGACTTAGTCAGTCTGTCCACAATAACCCATATAGAGTCATG
CTGCCTCCTAGTCCTCGGAAGACCAACTACTAAGTCCATATTAATGGCCTCCCATTTCCAAGTCGGAACCTCAATAACTGAATTCAAACACCAGACTTTA
GATGCTCTGCCTTATACTGCTGACAATTAGAAACTTATCTACATAGTCCTGCAATATCCTTCTTCATGCCTCCCCACCATTAATTGCCTAAGATTATGAT

>LE_HBa0098I01_T7_30721 (trimmed for quality and cloning vector)
AGCTTCCCTTTTCTACCAAATCGCATCACCCCTTTCATAGGCGATATCTTCAAGTAAACCTGGTCACCAACGTTAAATTCTAAGGGTCGCTTTCTGTTGT
CTGCATATGACTTCTGTCGGCTATAAGCGGTAGCCAACCTGTCTCTAATCATTCTAACTTTCTCCAGGGCCTCATGAATGATCTCTGGACCCAAAATAGA
TGACTCTCCAACCTCGAACCACCCAACTGGAGATCTACACCTCCTACCATACAATGCCTCAAATGGTGCCATCCCAATGCTGGAGTGGTAGCTATTATTA
TACGAGAACTCTATCAAAGGTAGATGGTCATCCCAATTACCTCTAAAGTCAATCACACACGCTCTCAACATGTCCTCCAATGTCTGAATAGTGCGCTCTG
CCTGCCCATCTGTCTGAGGATGAAAGGCAGTGCTAAGTTTCACCTGCGTGCCTAAGCTTTTCTGGAAAGATCTCCAAAAATGCGAAGTAAACTGAGCTCC
TCTATCTGAAATAATAGACAAAGGAATCCCATGCCATCTCACAATCTCATCAATGTAGAGTCTCATGTAATCCTCGGCCCTGTAAGTGGACTTCACAGGG
ATAAAGTGGGCAGACTTAGTCAGTCTGTCCACAATAACCCATATAGAGTCATGCTGCCTCCTAGTCCTCGGAAGACCAACTACTAAGTCCATATTAATGG
CCTCCCATTTCCAAGTCGGAACCTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.967966
Expected error %
0.577351
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 410 E Value 1e-113 Identity 25.70% Align. Length 722bp (99.59%) Frame 1
putative retrotransposon protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 409 E Value 1e-113 Identity 25.60% Align. Length 722bp (99.59%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0098I01
Clone
Clone name
hba-98i1
LE_HBa0098I01
C02HBa0098I01
P098I01
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found